Dataset for CDS classical BH3-containing proteins of organism Chinchilla lanigera

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2VWH6_PMAIP1-      --------------------------------------------------
A0A8C2W470_BAD-01       --------------------------------------------------
A0A8C2W470_BAD-02       --------------------------------------------------
A0A8C2VBL6_BMF-01       --------------------------------------------------
A0A8C2UGS8_BBC3-01      --------------------------------------------------
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      acacgcccgggtcggcggcgctcgcggcagggaacccggaggggccagcc
A0A8C2UYE1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2VWH6_PMAIP1-      ----------atgccgggaaaggtgtgtaaga------------------
A0A8C2W470_BAD-01       --------------------------------------atgcggactcca
A0A8C2W470_BAD-02       --------------------------------------------------
A0A8C2VBL6_BMF-01       ----------atgccccgagcgggc----------gtattttggaaacaa
A0A8C2UGS8_BBC3-01      ----------atggcccgtgcacgccaggagggcagctctccggagcccg
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      ccgcctttacctgtcccagcctgcacgcgccggcagccctcgcggcgcgg
A0A8C2UYE1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2VWH6_PMAIP1-      --------------------------------------------------
A0A8C2W470_BAD-01       gagaa---------------------------------------------
A0A8C2W470_BAD-02       --------------------------------------------------
A0A8C2VBL6_BMF-01       taccgcgcggtgtgccct--------------------------------
A0A8C2UGS8_BBC3-01      tagagggcctggcccgc---------------------------------
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      gggcgggacttgccctccctcgcgcggaggcgggacttggcgggggcggg
A0A8C2UYE1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2VWH6_PMAIP1-      --------------------------------------------------
A0A8C2W470_BAD-01       --------------------------------------------------
A0A8C2W470_BAD-02       --------------------------------------------------
A0A8C2VBL6_BMF-01       --------------------------------------------------
A0A8C2UGS8_BBC3-01      --------------------------------------------------
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      gcccgcggtgattggacgcgggcgcggagccgccagtcggagctgggctg
A0A8C2UYE1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2VWH6_PMAIP1-      --------gcacgccgccgccgaactccacgcgggcac------------
A0A8C2W470_BAD-01       --------gccctcacccgctcctacccacgccgaaagtt----------
A0A8C2W470_BAD-02       --------------------------------------------------
A0A8C2VBL6_BMF-01       --------ggcctcctccgcgcccgccccccgcgccgcccgcctcccgcc
A0A8C2UGS8_BBC3-01      --------gacggccctcgccccttccccctcggccgcctggtg------
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      ccgggccgcacaggtttcacttcgctccgcgcagcctctgggtgctgagc
A0A8C2UYE1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2VWH6_PMAIP1-      --------------------------------------------------
A0A8C2W470_BAD-01       --------------------------------------------------
A0A8C2W470_BAD-02       --------------------------------------------------
A0A8C2VBL6_BMF-01       g-------------------------------------------------
A0A8C2UGS8_BBC3-01      --------------------------------------------------
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      ttgctggagcgcagcgtcccgcgccgtcaccgccgccacaccaccgccgc
A0A8C2UYE1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2VWH6_PMAIP1-      --------------------------------------------------
A0A8C2W470_BAD-01       ----------------------------------taaggaagtctgagca
A0A8C2W470_BAD-02       --------------------------------------------------
A0A8C2VBL6_BMF-01       ----------------------------------cactgggctttcccct
A0A8C2UGS8_BBC3-01      ----------------------------------ccctcagctgtgtcct
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      cagcgtattcttacagttcccctgcgagccttgccccactgcagtcagca
A0A8C2UYE1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2VWH6_PMAIP1-      -------cggcagagctggcag----------------------------
A0A8C2W470_BAD-01       gggcatccggagacttggggcagcccagagc-------------------
A0A8C2W470_BAD-02       --------------------------------------------------
A0A8C2VBL6_BMF-01       ccttccccaccgagtctgggcgcccagcccccgagtgctcgtcacgctgg
A0A8C2UGS8_BBC3-01      gcggtctctgcgaacccggccttcctgctgcc-----cccaccac----c
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      ccgtcttcggcagctccagttgccccgctccc-----gccgccac----c
A0A8C2UYE1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2VWH6_PMAIP1-      --------------------------------------------------
A0A8C2W470_BAD-01       --------------------------------------------------
A0A8C2W470_BAD-02       --------------------------------------------------
A0A8C2VBL6_BMF-01       accctggcgcagagccctggcacc--------------------------
A0A8C2UGS8_BBC3-01      acccctgccctg--------------------------------------
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      gcctcggcgcccttccctggccctggtacccccaatgtctgactctgatt
A0A8C2UYE1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2VWH6_PMAIP1-      ---------------------------------ctgagtgtgctgct---
A0A8C2W470_BAD-01       ---------------------------------atgttccagatccc---
A0A8C2W470_BAD-02       ---------------------------------atgttccagatccc---
A0A8C2VBL6_BMF-01       ---------------------------------acgactcggaggccgat
A0A8C2UGS8_BBC3-01      ---------------------------------ctgccc--gcggcc---
A0A8C2UYE1_BCL2L11      ---------------------------------atggccaagcaacc---
A0A8C2UYE1_BCL2L11      ctcgaactgagaagcgcaagaaaaaaagaccaaatggccaagcaacc---
A0A8C2UYE1_BCL2L11      ---------------------------------atggccaagcaacc---
                                                           *     *   *    

A0A8C2VWH6_PMAIP1-      --------------cagcataggagaatcggagacaaa------------
A0A8C2W470_BAD-01       -----------------------agagtttgagccaag------------
A0A8C2W470_BAD-02       -----------------------agagtttgagccaag------------
A0A8C2VBL6_BMF-01       tctctctcctggagtcacccaggggagatggagccacctcagtgtgtgga
A0A8C2UGS8_BBC3-01      ---tacctctgc--gcccccac-------cgcaccacc------------
A0A8C2UYE1_BCL2L11      ---ttccgatgtaagtagtgag-------tgtgacaca------------
A0A8C2UYE1_BCL2L11      ---ttccgatgtaagtagtgag-------tgtgacaca------------
A0A8C2UYE1_BCL2L11      ---ttccgatgtaagtagtgag-------tgtgacaca------------
                                                      *   **              

A0A8C2VWH6_PMAIP1-      -----------ctgaatgccctgggttgtgccacggag------------
A0A8C2W470_BAD-01       -------tgagcaggaagactccagctctgaagagagg------------
A0A8C2W470_BAD-02       -------tgagcaggaagactccagctctgaagagagg------------
A0A8C2VBL6_BMF-01       ggagctggaagatgatgtattccaacc-tgaggatggggagccggggacc
A0A8C2UGS8_BBC3-01      --------------cgcccttacagccgcactgggggg---cccccgct-
A0A8C2UYE1_BCL2L11      -------gaaggtggacaattgcagcc-tgctgagaggccaccccagctc
A0A8C2UYE1_BCL2L11      -------gaaggtggacaattgcagcc-tgctgagaggccaccccagctc
A0A8C2UYE1_BCL2L11      -------gaaggtggacaattgcagcc-tgctgagaggccaccccagctc
                                                             *            

A0A8C2VWH6_PMAIP1-      -atcctggagac--------------------------------------
A0A8C2W470_BAD-01       -ggcctgggccccggccccacgggggaccggctaggcagcaacacagcag
A0A8C2W470_BAD-02       -ggcctgggccccggccccacgggggaccggctaggcagcaacacagcag
A0A8C2VBL6_BMF-01       cagcccgggagcctgctctctgctgatctgtttgcccagagccagctgga
A0A8C2UGS8_BBC3-01      -ggcctgggggc-------c------------------------------
A0A8C2UYE1_BCL2L11      aggcctggggccctgacctc------------------------------
A0A8C2UYE1_BCL2L11      aggcctggggccctgacctc------------------------------
A0A8C2UYE1_BCL2L11      aggcctggggccctgacctc------------------------------
                           ** **   *                                      

A0A8C2VWH6_PMAIP1-      ----------------------------------gcttgcagagatgcct
A0A8C2W470_BAD-01       gaggcttcctgggggac----------accagtcaccagcagaggcagct
A0A8C2W470_BAD-02       gaggcttcctgggggac----------accagtcaccagcagaggcagct
A0A8C2VBL6_BMF-01       ttgtccccttggtcggctgcacctcttccctctcacccactgctgtggcc
A0A8C2UGS8_BBC3-01      -----------------------------------cccgcagccg--gcc
A0A8C2UYE1_BCL2L11      -----------------------------------cctacagacggagcc
A0A8C2UYE1_BCL2L11      -----------------------------------cctacagacggagcc
A0A8C2UYE1_BCL2L11      -----------------------------------cctacagacggagcc
                                                           *   * *      * 

A0A8C2VWH6_PMAIP1-      gggaagaaagc---------------------------------------
A0A8C2W470_BAD-01       gagaagca-gcagccaccatggaggcgctggggctatggacacccggagt
A0A8C2W470_BAD-02       gagaagca-gcagccaccatggaggcgctggggctatggacacccggagt
A0A8C2VBL6_BMF-01       ctgggcttcgccccaccagccaggaagacaaggccactcagaccctcagc
A0A8C2UGS8_BBC3-01      ccgaggcccgc---------------------gccctgatggtcctcagc
A0A8C2UYE1_BCL2L11      ccaa----------------------------------------------
A0A8C2UYE1_BCL2L11      ccaagacagga---------------------gcccgg--------cacc
A0A8C2UYE1_BCL2L11      ccaagacagga---------------------gcccgg--------cacc
                                                                          

A0A8C2VWH6_PMAIP1-      ------------------------------------------tcggaaga
A0A8C2W470_BAD-01       cgccacagctcatatcccacagggatggaggaagaggaagggatggagga
A0A8C2W470_BAD-02       cgccacagctcatatcccacagggatggaggaagaggaagggatggagga
A0A8C2VBL6_BMF-01       ccatcctctccaagccagggtgtcatgctgccttgtggggtgactgagga
A0A8C2UGS8_BBC3-01      cacccctctc----------------------------ggcggccgagca
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      tatgagttgt----------------------------gacaaatcaaca
A0A8C2UYE1_BCL2L11      tatgagttgt----------------------------gacaaatcaaca
                                                                          

A0A8C2VWH6_PMAIP1-      --------------------------------------------------
A0A8C2W470_BAD-01       ggagcccagtccattccggggc----------------------------
A0A8C2W470_BAD-02       ggagcccagtccattccggggc----------------------------
A0A8C2VBL6_BMF-01       accccagcgactcttttatggcaatgctggctatcggcttcctctccctg
A0A8C2UGS8_BBC3-01      -gcacctagagtcgcccgtgcc---------------------cagcgcc
A0A8C2UYE1_BCL2L11      --------------------------------------------------
A0A8C2UYE1_BCL2L11      caaaccccaagtcctccttgccaggcct--tcaaccattatctcagtgca
A0A8C2UYE1_BCL2L11      caaaccccaagtcctccttgccaggcct--tcaaccattatctcagtgca
                                                                          

A0A8C2VWH6_PMAIP1-      ------------gcgcgcagctgactctgaccggggcacccg--------
A0A8C2W470_BAD-01       -------cgctcgcgctcggcgcctcccaa------cctctgggct----
A0A8C2W470_BAD-02       -------cgctcgcgctcggcgcctcccaa------cctctgggct----
A0A8C2VBL6_BMF-01       ccagtttccctg-caggcttgccccttgaggagcagcccccgga------
A0A8C2UGS8_BBC3-01      ccggaggccctggcgggcggtcccacccaggcgg--cccccggggtccgg
A0A8C2UYE1_BCL2L11      ---gcttccatg--aggcagt----ctcaggctgaacctccggatt----
A0A8C2UYE1_BCL2L11      atggcttccatg--aggcagt----ctcaggctgaacctccggatt----
A0A8C2UYE1_BCL2L11      atggcttccatg--aggcagt----ctcaggctgaacctccggatt----
                                         *                  *  * *        

A0A8C2VWH6_PMAIP1-      ----------------------------cagagctggaagtcgagtgtgc
A0A8C2W470_BAD-01       -------------------------gcacagcgcta-----cggccgag-
A0A8C2W470_BAD-02       -------------------------gcacagcgcta-----cggccgag-
A0A8C2VBL6_BMF-01       --------aggtcagtggcaacatcgcgcagaggtacagatcgcccgga-
A0A8C2UGS8_BBC3-01      ggggaggaggagcagtg-------ggcccggg-----agatcggggcgc-
A0A8C2UYE1_BCL2L11      ---------------tg-------cgcccagagatatggatcgcacagg-
A0A8C2UYE1_BCL2L11      ---------------tg-------cgcccagagatatggatcgcacagg-
A0A8C2UYE1_BCL2L11      ---------------tg-------cgcccagagatatggatcgcacagg-
                                                    * *          **       

A0A8C2VWH6_PMAIP1-      cgctcagttcagaagaattggagataaactg-------------------
A0A8C2W470_BAD-01       -----agctccggaggatgagcgatgaattcgtggactccttcaagggtc
A0A8C2W470_BAD-02       -----agctccggaggatgagcgatgaattcgtggactccttcaagggtc
A0A8C2VBL6_BMF-01       -----agcttcggtgcattgcagaccagttc-----------caccggct
A0A8C2UGS8_BBC3-01      -----agctgcggcggatggcggacgacctc-----------aacgcgca
A0A8C2UYE1_BCL2L11      -----agttgcgccgcatcggagatgagttt-----------aatgcctc
A0A8C2UYE1_BCL2L11      -----agttgcgccgcatcggagatgagttt-----------aatgcctc
A0A8C2UYE1_BCL2L11      -----agttgcgccgcatcggagatgagttt-----------aatgcctc
                             ** *  *  * **    **  *  *                    

A0A8C2VWH6_PMAIP1-      -aatttccggcagaaacttatgaatt------------------------
A0A8C2W470_BAD-01       ttcctcgcccgaagagcgcgggtacagcgacgaagctgtggcaga-----
A0A8C2W470_BAD-02       ttcctcgcccgaagagcgcgggtacagcgacgaagctgtggcaga-----
A0A8C2VBL6_BMF-01       tcacatgcaacaacgccaacagaacc---------------agaatcgcg
A0A8C2UGS8_BBC3-01      gtacgagcggaggagacaagaggagc-------agcagc--gacaccgcc
A0A8C2UYE1_BCL2L11      ttacccaaggagggtattcttgaatcattaccaagcagctgaagacca--
A0A8C2UYE1_BCL2L11      ttacccaaggagggtattcttgaatcattaccaagcagctgaagacca--
A0A8C2UYE1_BCL2L11      ttacccaaggagggtattcttgaatcattaccaagcagctgaagacca--
                                             * *                          

A0A8C2VWH6_PMAIP1-      ---------------tgatttccaaactcttcagtttag-----------
A0A8C2W470_BAD-01       ----gctccaactggacacgcgccatccagtcctggtgggatcggaactt
A0A8C2W470_BAD-02       ----gctccaactggacacgcgccatccagtcctggtgggatcggaactt
A0A8C2VBL6_BMF-01       tgtggtggcaggtcctactcttcctgcacaacc---tgggtctg----aa
A0A8C2UGS8_BBC3-01      cgtcaccctggagggtcctgtacaatctcatca---tgggactcctgccc
A0A8C2UYE1_BCL2L11      ----gccccaaatgg------------ttatct---tgcgactgttacgt
A0A8C2UYE1_BCL2L11      ----gccccaaatgg------------ttatct---tgcgactgttacgt
A0A8C2UYE1_BCL2L11      ----gccccaaatgg------------ttatct---tgcgactgttacgt
                                                       *    *             

A0A8C2VWH6_PMAIP1-      -----------------------------------taacctga
A0A8C2W470_BAD-01       ggggagaggaggctctgccccct------------cccagtga
A0A8C2W470_BAD-02       ggggagaggaggctctgccccct------------cccagtga
A0A8C2VBL6_BMF-01       tggagaagagaacagagaa-----ggggtgggtccca-ggtga
A0A8C2UGS8_BBC3-01      ttacccaggggccacggagcccccgagatggagccca-attag
A0A8C2UYE1_BCL2L11      t----------acattgtccgcctggtgtggaggatgcactga
A0A8C2UYE1_BCL2L11      t----------acattgtccgcctggtgtggaggatgcactga
A0A8C2UYE1_BCL2L11      t----------acattgtccgcctggtgtggaggatgcactga
                                                                *  

© 1998-2022Legal notice