Dataset for CDS BAD of organism Chinchilla lanigera

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C2W470_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chinchilla lanigera GN=BAD (length=585 residues).
atgcggactccagagaagccctcacccgctcctacccacgccgaaagtttaaggaagtctgagcagggcatccggagact
tggggcagcccagagcatgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgaagagaggggcc
tgggccccggccccacgggggaccggctaggcagcaacacagcaggaggcttcctgggggacaccagtcaccagcagagg
cagctgagaagcagcagccaccatggaggcgctggggctatggacacccggagtcgccacagctcatatcccacagggat
ggaggaagaggaagggatggaggaggagcccagtccattccggggccgctcgcgctcggcgcctcccaacctctgggctg
cacagcgctacggccgagagctccggaggatgagcgatgaattcgtggactccttcaagggtcttcctcgcccgaagagc
gcgggtacagcgacgaagctgtggcagagctccaactggacacgcgccatccagtcctggtgggatcggaacttggggag
aggaggctctgccccctcccagtga
>gnl|bcl2dbcds|A0A8C2W470_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chinchilla lanigera GN=BAD (length=489 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgaagagaggggcctgggccccggccccac
gggggaccggctaggcagcaacacagcaggaggcttcctgggggacaccagtcaccagcagaggcagctgagaagcagca
gccaccatggaggcgctggggctatggacacccggagtcgccacagctcatatcccacagggatggaggaagaggaaggg
atggaggaggagcccagtccattccggggccgctcgcgctcggcgcctcccaacctctgggctgcacagcgctacggccg
agagctccggaggatgagcgatgaattcgtggactccttcaagggtcttcctcgcccgaagagcgcgggtacagcgacga
agctgtggcagagctccaactggacacgcgccatccagtcctggtgggatcggaacttggggagaggaggctctgccccc
tcccagtga
© 1998-2022Legal notice