Dataset for CDS BAD of organism Chinchilla lanigera

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2W470_BAD-01      atgcggactccagagaagccctcacccgctcctacccacgccgaaagttt
A0A8C2W470_BAD-02      --------------------------------------------------
                                                                         

A0A8C2W470_BAD-01      aaggaagtctgagcagggcatccggagacttggggcagcccagagcatgt
A0A8C2W470_BAD-02      ----------------------------------------------atgt
                                                                     ****

A0A8C2W470_BAD-01      tccagatcccagagtttgagccaagtgagcaggaagactccagctctgaa
A0A8C2W470_BAD-02      tccagatcccagagtttgagccaagtgagcaggaagactccagctctgaa
                       **************************************************

A0A8C2W470_BAD-01      gagaggggcctgggccccggccccacgggggaccggctaggcagcaacac
A0A8C2W470_BAD-02      gagaggggcctgggccccggccccacgggggaccggctaggcagcaacac
                       **************************************************

A0A8C2W470_BAD-01      agcaggaggcttcctgggggacaccagtcaccagcagaggcagctgagaa
A0A8C2W470_BAD-02      agcaggaggcttcctgggggacaccagtcaccagcagaggcagctgagaa
                       **************************************************

A0A8C2W470_BAD-01      gcagcagccaccatggaggcgctggggctatggacacccggagtcgccac
A0A8C2W470_BAD-02      gcagcagccaccatggaggcgctggggctatggacacccggagtcgccac
                       **************************************************

A0A8C2W470_BAD-01      agctcatatcccacagggatggaggaagaggaagggatggaggaggagcc
A0A8C2W470_BAD-02      agctcatatcccacagggatggaggaagaggaagggatggaggaggagcc
                       **************************************************

A0A8C2W470_BAD-01      cagtccattccggggccgctcgcgctcggcgcctcccaacctctgggctg
A0A8C2W470_BAD-02      cagtccattccggggccgctcgcgctcggcgcctcccaacctctgggctg
                       **************************************************

A0A8C2W470_BAD-01      cacagcgctacggccgagagctccggaggatgagcgatgaattcgtggac
A0A8C2W470_BAD-02      cacagcgctacggccgagagctccggaggatgagcgatgaattcgtggac
                       **************************************************

A0A8C2W470_BAD-01      tccttcaagggtcttcctcgcccgaagagcgcgggtacagcgacgaagct
A0A8C2W470_BAD-02      tccttcaagggtcttcctcgcccgaagagcgcgggtacagcgacgaagct
                       **************************************************

A0A8C2W470_BAD-01      gtggcagagctccaactggacacgcgccatccagtcctggtgggatcgga
A0A8C2W470_BAD-02      gtggcagagctccaactggacacgcgccatccagtcctggtgggatcgga
                       **************************************************

A0A8C2W470_BAD-01      acttggggagaggaggctctgccccctcccagtga
A0A8C2W470_BAD-02      acttggggagaggaggctctgccccctcccagtga
                       ***********************************

© 1998-2022Legal notice