Dataset for CDS classical BH3-containing proteins of organism Chelydra serpentina

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C3RPK7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Chelydra serpentina GN=PMAIP1 (length=177 residues).
agtgttgacaagaaagtgtatggaattcacaaagctgatgactggttttcctttgtgtttacagcacaggaagctgtgac
ccagtgctctttgcaactacgcaaaatcggagatatatgcaacctgcagcagaagattcttaatgttattacaaaactgt
tctgcccaggaacgtga
>gnl|bcl2dbcds|A0A8C3RZA1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Chelydra serpentina GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttctgatctaaattcagagtgcaacagagaaggtggacagtttcagtcaattgaaaggccaagtca
gcctcagcatcttagacctggggcccctacctctatacaaacacagtatcaaggtaatcatacaggtgagggggacttcg
cccagcagccctcagggagctcttcgcccagcagccctcagggaccatttgcaccacccagtagccccagtccgttcgct
accagatccccacttttcatctttgtaagaagatcctcactgctgtctagatcctccagtgggtatttctctttcgacac
agacaggagtcctgcgcctatgagttgcgacaagtccacgcagactccaagtcccccttgtcaagcctttaatcattatc
taagtgcaatggcttccaggtgggaatctccctcaatacgtgaagacatgcagccagaaatatggattgcacaggaactg
cggcgtattggagatgagtttaatgcttcctattgcccaagaagggtaactttattttattttatttttttaattttctt
aaaaattgtgtgggggagagggggagtttag
>gnl|bcl2dbcds|A0A8C3RZA1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Chelydra serpentina GN=BCL2L11 (length=402 residues).
atggcaaagcaaccttctgatctaaattcagagtgcaacagagaaggtggacagtttcagtcaattgaaaggccaagtca
gcctcagcatcttagacctggggcccctacctctatacaaacacagtatcaagacaggagtcctgcgcctatgagttgcg
acaagtccacgcagactccaagtcccccttgtcaagcctttaatcattatctaagtgcaatggcttccaggtgggaatct
ccctcaatacgtgaagacatgcagccagaaatatggattgcacaggaactgcggcgtattggagatgagtttaatgcttc
ctattgcccaagaagggtaactttattttattttatttttttaattttcttaaaaattgtgtgggggagagggggagttt
ag
>gnl|bcl2dbcds|A0A8C3S2L3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chelydra serpentina GN=BAD (length=465 residues).
atgtttcgcatccaggagttcccggacgaggtgttcccggggcgagggaaggagtcgcctgctcctcccgagtcgcagcg
gggacacacgcccggctccaagcagccaggcacccccacagctgaggtgcgaagccggatagggtcagaccccccatctc
tggagccagaagtgcaggatgagccaggtggggcattccgggcacgctcacgctcagccccccctatactctgggctgct
atgcgttacggacgggagctgcgcaggatgagtgacgagtttgacgtagcactgcaggtgctgccacgccccaagagtgc
gggcacgacttcccagctgcactgggggaacagctggaaagagacgctccaggcctggttggggcacagacctgcccgtg
atgcccccgcaggagctccaagtgactgcagcctccctgctggggggatgggaccagccccttga
>gnl|bcl2dbcds|A0A8C3XI05_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Chelydra serpentina GN=BMF (length=579 residues).
atggatccccccagctacctggaagaggactattccagcctggacgggctggacgatgacgtgtttcactctgactttgg
actcacaggtcagcctggtgagatgacccctcctggcattttcacacagaaccaatcctacagctgcctgctggggaggt
ttcaactgttcccactcacacactgctgtggtccaggtatcaggcatgctgagcagcaggacaaggcaacccaaacactc
agtccatcctcttccactcaggatgtcatgttgccatgtggagtcactgaagagccccagagactcttctatggaaatgc
tgggtaccgtttacatgtccccccagttggctttgcattgaatccacacctccaagaggagcctcgggaaggtcaacggg
aagcacgtgctgaggttcagattgcacggaagttacagtgcattgcagaccagttccacaggctccacatacagaggcat
cagcagaacagaaatcaagtgtggtggcagatccttctcttcctacataacttggccttaaatgtggaggcgaacaggaa
ccacataggtcagaggtga
© 1998-2022Legal notice