Dataset for CDS classical BH3-containing proteins of organism Chelydra serpentina

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3S2L3_BAD-01       atgtttcgcatccaggagttcccggacgaggtgttccc------------
A0A8C3XI05_BMF-01       atggatcccccc---agctacctggaagaggactattccagcctggac--
A0A8C3RPK7_PMAIP1-      --------------------------------------------------
A0A8C3RZA1_BCL2L11      ---------------------atggcaaagcaaccttctgatctaaattc
A0A8C3RZA1_BCL2L11      ---------------------atggcaaagcaaccttctgatctaaattc
                                                                          

A0A8C3S2L3_BAD-01       --ggggcgagggaaggagtcg---cctgctcctcccgagtcgcag-----
A0A8C3XI05_BMF-01       --gggctggacgatgacgtgtttcactctgactttggactcacag-----
A0A8C3RPK7_PMAIP1-      --agtgttgacaagaaagtgt---atgg--------aattcacaa-----
A0A8C3RZA1_BCL2L11      agagtgcaacagagaaggtgg---acagtttcagtcaattgaaaggccaa
A0A8C3RZA1_BCL2L11      agagtgcaacagagaaggtgg---acagtttcagtcaattgaaaggccaa
                           *        *    **                  * *   *      

A0A8C3S2L3_BAD-01       --------cggggacacacgcccggctccaagcagccaggcacccccaca
A0A8C3XI05_BMF-01       gtcagcctggtgagatgacccct------------cctggcattttcaca
A0A8C3RPK7_PMAIP1-      ------------agctgatgactggttt-------tcctttgtgtttaca
A0A8C3RZA1_BCL2L11      gtcagcctcagcatcttagacctggggc-------ccctacctctataca
A0A8C3RZA1_BCL2L11      gtcagcctcagcatcttagacctggggc-------ccctacctctataca
                                         *   *              *          ***

A0A8C3S2L3_BAD-01       gctgaggtgcgaa-------------------------------------
A0A8C3XI05_BMF-01       ----cagaaccaa-------------------------tcctacagctgc
A0A8C3RPK7_PMAIP1-      --------------------------------------------------
A0A8C3RZA1_BCL2L11      aacacagtatcaaggtaatcatacaggtgagggggacttcgcccagcagc
A0A8C3RZA1_BCL2L11      aacacagtatca--------------------------------------
                                                                          

A0A8C3S2L3_BAD-01       --gccggatagggtcagacccccca-------------------------
A0A8C3XI05_BMF-01       ctgctggggaggtttcaactgttcccactcacacactgctgtg-------
A0A8C3RPK7_PMAIP1-      --------------------------------------------------
A0A8C3RZA1_BCL2L11      cctcagggagctcttcgcccagcagccctcagggaccatttgcaccaccc
A0A8C3RZA1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C3S2L3_BAD-01       --------------------------------------------------
A0A8C3XI05_BMF-01       --------------------------------------------------
A0A8C3RPK7_PMAIP1-      --------------------------------------------------
A0A8C3RZA1_BCL2L11      agtagccccagtccgttcgctaccagatccccacttttcatctttgtaag
A0A8C3RZA1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C3S2L3_BAD-01       --------------------------------------------------
A0A8C3XI05_BMF-01       --------------------------------------------------
A0A8C3RPK7_PMAIP1-      --------------------------------------------------
A0A8C3RZA1_BCL2L11      aagatcctcactgctgtctagatcctccagtgggtatttctctttcgaca
A0A8C3RZA1_BCL2L11      --------------------------------------------------
                                                                          

A0A8C3S2L3_BAD-01       -tctctggagccagaagtgcaggatgagccaggtggggcattccgggcac
A0A8C3XI05_BMF-01       -gtccaggtatcaggcatgc-tgagcagcaggacaaggc--------aac
A0A8C3RPK7_PMAIP1-      -gcacagga--------------agctgt--ga-----------------
A0A8C3RZA1_BCL2L11      cagacaggagtcctgcgcctatgagttgc--gacaagtc--------cac
A0A8C3RZA1_BCL2L11      -agacaggagtcctgcgcctatgagttgc--gacaagtc--------cac
                            * **               *   *   *                  

A0A8C3S2L3_BAD-01       gctcacgctcagccc-----------------------------------
A0A8C3XI05_BMF-01       ccaaacactcagtccatcctcttccactcaggatgtcatgttgccatgtg
A0A8C3RPK7_PMAIP1-      -------cccagtgc-----------------------------------
A0A8C3RZA1_BCL2L11      gcagactccaagtcc-----------------------------------
A0A8C3RZA1_BCL2L11      gcagactccaagtcc-----------------------------------
                               *  **  *                                   

A0A8C3S2L3_BAD-01       ---cccctat----------------------------------------
A0A8C3XI05_BMF-01       gagtcactgaagagccccagagactcttctatggaaatgctgggtaccgt
A0A8C3RPK7_PMAIP1-      ---tctttgc----------------------------------------
A0A8C3RZA1_BCL2L11      ---cccttgtcaagcctttaatcattatctaagtgca-------------
A0A8C3RZA1_BCL2L11      ---cccttgtcaagcctttaatcattatctaagtgca-------------
                            *  *                                          

A0A8C3S2L3_BAD-01       --------------------------------------------------
A0A8C3XI05_BMF-01       ttacatgtccccccagttggctttgcattgaatccacacctccaagagga
A0A8C3RPK7_PMAIP1-      --------------------------------------------------
A0A8C3RZA1_BCL2L11      ----atggcttccaggtgggaatctccctcaatacgtg------------
A0A8C3RZA1_BCL2L11      ----atggcttccaggtgggaatctccctcaatacgtg------------
                                                                          

A0A8C3S2L3_BAD-01       ---------------------actctgggctgctatgcgttacggacggg
A0A8C3XI05_BMF-01       gcctcgggaaggtcaacgggaagcacgtgctgaggttcagattgcacgga
A0A8C3RPK7_PMAIP1-      --------------------------------------------------
A0A8C3RZA1_BCL2L11      -----------------aagacatgcagccagaaatatggattgcacagg
A0A8C3RZA1_BCL2L11      -----------------aagacatgcagccagaaatatggattgcacagg
                                                                          

A0A8C3S2L3_BAD-01       agctgcgcaggatgagtgacgagtttgacgtagcactgcaggtgctgcca
A0A8C3XI05_BMF-01       agttacagtgcattgcagaccagttcca----------------------
A0A8C3RPK7_PMAIP1-      aactacgcaaaatcggagata-----ta----------------------
A0A8C3RZA1_BCL2L11      aactgcggcgtattggagatgagtttaa----------------------
A0A8C3RZA1_BCL2L11      aactgcggcgtattggagatgagtttaa----------------------
                        *  * *     **    **        *                      

A0A8C3S2L3_BAD-01       cgccccaagagtgcgggcacgacttcccagctgcactgggggaacagctg
A0A8C3XI05_BMF-01       -------------caggctccacat---------acagaggcatcagcag
A0A8C3RPK7_PMAIP1-      -------------tg----caacct---------gcag------cagaag
A0A8C3RZA1_BCL2L11      -------------tg----cttcct---------attg------cccaag
A0A8C3RZA1_BCL2L11      -------------tg----cttcct---------attg------cccaag
                                           *  * *            *      *    *

A0A8C3S2L3_BAD-01       gaaagagacgctccaggcctggttggggcacagacctgcccgtgatgccc
A0A8C3XI05_BMF-01       aacagaaa----tcaagtgtggtgg---------cagatcctt-ctcttc
A0A8C3RPK7_PMAIP1-      a-------------------------------------ttcttaatgtta
A0A8C3RZA1_BCL2L11      aagggtaa----ctttattttattt---------tatttttttaattttc
A0A8C3RZA1_BCL2L11      aagggtaa----ctttattttattt---------tatttttttaattttc
                                                                  *  *    

A0A8C3S2L3_BAD-01       ccgcaggagctccaagtgactgcagcctccctgctggggggatgggacca
A0A8C3XI05_BMF-01       ctacataacttggccttaaatgtgg----------aggcgaacaggaacc
A0A8C3RPK7_PMAIP1-      ttacaaaact---------gttctg----------ccca-----ggaac-
A0A8C3RZA1_BCL2L11      tta-aaaatt---------gtgtgg----------gggagagggggagt-
A0A8C3RZA1_BCL2L11      tta-aaaatt---------gtgtgg----------gggagagggggagt-
                            *  *            *   *                   ***   

A0A8C3S2L3_BAD-01       gcccc--------ttga
A0A8C3XI05_BMF-01       acataggtcagaggtga
A0A8C3RPK7_PMAIP1-      -------------gtga
A0A8C3RZA1_BCL2L11      -------------ttag
A0A8C3RZA1_BCL2L11      -------------ttag
                                      *  

© 1998-2022Legal notice