Dataset for CDS BAD of organism Cercocebus atys

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K5M0A7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cercocebus atys GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagtctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggggagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2K5M0A7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cercocebus atys GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagtctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgaccttcgc
tccacgccccgaaactccacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
© 1998-2020Legal notice