Dataset for CDS BAD of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5M0A7_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5M0A7_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5M0A7_BAD-03      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc

A0A2K5M0A7_BAD-02      tgcagagaggggcctgggccccagtctcgcgggggacaggccctcagact
A0A2K5M0A7_BAD-01      tgcagagaggggcctgggccccagtctcgcgggggacaggccctcagact
A0A2K5M0A7_BAD-03      tgcagagaggggcctgggccccagtctcgcgggggacaggccctcagact

A0A2K5M0A7_BAD-02      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5M0A7_BAD-01      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5M0A7_BAD-03      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac

A0A2K5M0A7_BAD-02      cagcaggagcagccaaccagcagcagccatcatggaggg-----------
A0A2K5M0A7_BAD-01      cagcaggagcagccaaccagcagcagccatcatgg---------------
A0A2K5M0A7_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggggagcttggta

A0A2K5M0A7_BAD-02      --------------------------------------------------
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc

A0A2K5M0A7_BAD-02      ----------------------------------------------actt
A0A2K5M0A7_BAD-01      --------------------------------------------------
A0A2K5M0A7_BAD-03      tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc

A0A2K5M0A7_BAD-02      cctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccag
A0A2K5M0A7_BAD-01      -------------------------aggcgctggggctgtggagacccgg
A0A2K5M0A7_BAD-03      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacccgg
                                                 * *** *  ** *   **  ** *

A0A2K5M0A7_BAD-02      ctggacgcgagtcttccagtcctggtgggatcg--------gaacttggg
A0A2K5M0A7_BAD-01      --agtcgccacagctcctaccccgcggggacggaggaggacgaagggatg
A0A2K5M0A7_BAD-03      --agtcgccacagctcctaccccgcggggacggaggaggacgaagggatg
                          * *** *    ***   ** *  ****  *        ***     *

A0A2K5M0A7_BAD-02      caggggaagctccgccccctcc-cagtgaccttcgctccacgccccgaaa
A0A2K5M0A7_BAD-01      gaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaa
A0A2K5M0A7_BAD-03      gaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaa
                        *** * *** * ***** * *   *   *   ****** ******  **

A0A2K5M0A7_BAD-02      ctccacccgctctcactgtcctggtcggccatcttggatatgggcggaag
A0A2K5M0A7_BAD-01      cctc------------------------------------tgggcagcac
A0A2K5M0A7_BAD-03      cctc------------------------------------tgggcagcac
                       *  *                                    ***** * * 

A0A2K5M0A7_BAD-02      tgcttccctcaggccttatgcaaaagaggatccgtgctgcctctttcg--
A0A2K5M0A7_BAD-01      agcgt---tatggccgcgagctccggaggatgagtgacgagtttgtggac
A0A2K5M0A7_BAD-03      agcgt---tatggccgcgagctccggaggatga-----------------
                        ** *   *  ****    **    ******                   

A0A2K5M0A7_BAD-02      ------------------------------gtgggagggctgacccagat
A0A2K5M0A7_BAD-01      tcctttaagggacttcctcgcccgaagagcgcgggcacagcgacgcagat
A0A2K5M0A7_BAD-03      --------------------------------------------------

A0A2K5M0A7_BAD-02      tc------------------------------------------------
A0A2K5M0A7_BAD-01      gcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcgga
A0A2K5M0A7_BAD-03      --------------------------------------------------

A0A2K5M0A7_BAD-02      ------------------ccttccggtgcatgtga
A0A2K5M0A7_BAD-01      acttgggcaggggaagctccgccccctcccagtga
A0A2K5M0A7_BAD-03      -----------------------------------

© 1998-2022Legal notice