Dataset for CDS BAD of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5M0A7_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A2K5M0A7_BAD-03      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc

A0A2K5M0A7_BAD-02      tgcagagaggggcctgggccccagtctcgcgggggacaggccctcagact
A0A2K5M0A7_BAD-03      tgcagagaggggcctgggccccagtctcgcgggggacaggccctcagact

A0A2K5M0A7_BAD-02      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2K5M0A7_BAD-03      gcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac

A0A2K5M0A7_BAD-02      cagcaggagcagccaaccagcagcagccatcatggaggga----------
A0A2K5M0A7_BAD-03      cagcaggagcagccaaccagcagcagccatcatggagggggagcttggta

A0A2K5M0A7_BAD-02      -----cttcctcg---cccgaagagcgcgggcacagcgacgca--gatg-
A0A2K5M0A7_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
                            **** * *    * ** **    *   *   *   ***  **** 

A0A2K5M0A7_BAD-02      -cggcaaagctccagctggacgcgagtct--tccagtcctggtgggatcg
A0A2K5M0A7_BAD-03      tcgcggaagcatcagc---acggatgtctgccccagcc------------
                        **   ****  ****   ***   ****   **** *            

A0A2K5M0A7_BAD-02      gaacttgggcaggggaagctccgccccctcccagtgacctt--cgctcca
A0A2K5M0A7_BAD-03      --actgactca---gaagc----ccaacacgcagagaatgtaaagctgaa
                         ***    **   *****    **  * * *** **   *   ***  *

A0A2K5M0A7_BAD-02      cgccccgaaactcc----acccgctctcactg----tcctggtcggccat
A0A2K5M0A7_BAD-03      ggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggg
                        ** * *   **      *****   ** *      ****   * **   

A0A2K5M0A7_BAD-02      cttggatatgggcggaagt----------------gcttccctc-aggcc
A0A2K5M0A7_BAD-03      gacggaggaggacgaagggatggaggaggagcccagcccctttcggggcc
                          ***   ** ** * *                 **  *  **  ****

A0A2K5M0A7_BAD-02      ttatgcaaaagaggatccgtgctgcc---tctttcggtgggagggc----
A0A2K5M0A7_BAD-03      gctcgc-------gctccgcgccccccaacctctgggcagcacagcgtta
                           **       * **** **  **    ** * **  * *  **    

A0A2K5M0A7_BAD-02      tgacccagattcccttccggtgcatgtga
A0A2K5M0A7_BAD-03      tggccgcgag----ctccggagga--tga
                       ** **  **      ***** * *  ***

© 1998-2020Legal notice