Dataset for CDS BCL2L11 of organism Cebus imitator

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaa
cctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
gagggtatttttgaataattaccaagcagccgaagaccacccacacatggttatcttacgactgttacgttacattgtcc
gcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagccgaagaccacccacacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttccatctgattga
>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaatctcaggctgaacctgcaggta
tgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaaggaggctggca
aaactcttggcatcctccacctga
>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatggctgact
gggcctag
>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctcccttgga
attgcccttcgtagggaggttcagtggccagttgagtggttagcaaaatccagctga
>gnl|bcl2dbcds|A0A2K5Q1U2_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Cebus imitator GN=BCL2L11 (length=276 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatgggtgatatttcattgtggtttagtcaa
ggtacagaacaactccatcacaagtatttctcatga
© 1998-2021Legal notice