Dataset for CDS BCL2L11 of organism Cebus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Q1U2_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5Q1U2_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
                        **************************************************

A0A2K5Q1U2_BCL2L11      cctccctacagacagagccacaag--------------------------
A0A2K5Q1U2_BCL2L11      cctccctacagacagagccacaag--------------------------
A0A2K5Q1U2_BCL2L11      cctccctacagacagagccacaag--------------------------
A0A2K5Q1U2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2K5Q1U2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5Q1U2_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
                        **********************                            

A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5Q1U2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5Q1U2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5Q1U2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5Q1U2_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                                                                          

A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5Q1U2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5Q1U2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5Q1U2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5Q1U2_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
                                                                          

A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5Q1U2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5Q1U2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5Q1U2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5Q1U2_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A2K5Q1U2_BCL2L11      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Q1U2_BCL2L11      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Q1U2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Q1U2_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Q1U2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Q1U2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Q1U2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Q1U2_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                          

A0A2K5Q1U2_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatggat----
A0A2K5Q1U2_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatgggt----
A0A2K5Q1U2_BCL2L11      --------------------------------------------cttcca
A0A2K5Q1U2_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatggtt----
A0A2K5Q1U2_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaat--------
A0A2K5Q1U2_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5Q1U2_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5Q1U2_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5Q1U2_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5Q1U2_BCL2L11      aagtcctacttgccaggccttcaaccactatctcagtgcaatggct----
                                                                          

A0A2K5Q1U2_BCL2L11      ----gaggccactggatcctcccttggaattgcccttcgtagggaggttc
A0A2K5Q1U2_BCL2L11      ----gatatttcat----------------------------tgtggttt
A0A2K5Q1U2_BCL2L11      tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatc
A0A2K5Q1U2_BCL2L11      -------------------------------------agagaaataga--
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatc
A0A2K5Q1U2_BCL2L11      tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatc
A0A2K5Q1U2_BCL2L11      tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatc
A0A2K5Q1U2_BCL2L11      tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatc
A0A2K5Q1U2_BCL2L11      -------------gactgggcctag-------------------------
                                                                          

A0A2K5Q1U2_BCL2L11      agtggccagttgagtggttagcaaaatccagctga---------------
A0A2K5Q1U2_BCL2L11      agtcaag---------gtacagaacaactccatcacaagtatttctcatg
A0A2K5Q1U2_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
A0A2K5Q1U2_BCL2L11      ----ggaagttgtcgtgtag------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
A0A2K5Q1U2_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
A0A2K5Q1U2_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
A0A2K5Q1U2_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      a-------------------------------------------------
A0A2K5Q1U2_BCL2L11      gaggctg------------gcaaaa-------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --gggtattttt-------gaataa-------------------------
A0A2K5Q1U2_BCL2L11      gagggtattttt-------gaataattaccaagcagccgaagaccaccca
A0A2K5Q1U2_BCL2L11      gagggtattttt-------gaataattaccaagcagccgaagaccaccca
A0A2K5Q1U2_BCL2L11      gaggatatctcttccatctgattga-------------------------
A0A2K5Q1U2_BCL2L11      gaggtta------------gagaaatag----------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      ----------------------ctcttggcatcctccacctga-------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      cacatggttatcttacgactgttacgttacattgtccgcctggtgtggag
A0A2K5Q1U2_BCL2L11      cacatggttatcttacgactgttacgttacattgtccgcctggtgtggag
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
A0A2K5Q1U2_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5Q1U2_BCL2L11      ----------
A0A2K5Q1U2_BCL2L11      ----------
A0A2K5Q1U2_BCL2L11      ----------
A0A2K5Q1U2_BCL2L11      ----------
A0A2K5Q1U2_BCL2L11      ----------
A0A2K5Q1U2_BCL2L11      aatgcattga
A0A2K5Q1U2_BCL2L11      aatgcattga
A0A2K5Q1U2_BCL2L11      ----------
A0A2K5Q1U2_BCL2L11      ----------
A0A2K5Q1U2_BCL2L11      ----------
                                  

© 1998-2021Legal notice