Dataset for CDS PMAIP1 of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A452EST2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Capra hircus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaggagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgagtgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatagccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A8C2P9C6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Capra hircus GN=PMAIP1 (length=156 residues).
aggagggctcgtaggagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgagtgtgccattcagttgag
gagaattggagacaaactgaatttccggcagaaacttgtgaatctgatagccaaactcctccgctcaggaacttga
>gnl|bcl2dbcds|A0A8C2R6N9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Capra hircus GN=PMAIP1 (length=159 residues).
cagactgggggctgggggctgtgcagttctcaaccccttgatcctctgaagaatcctgaagttgagtgtgccattcagtt
gaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatagccaaactcctccgctcaggaacttga
© 1998-2022Legal notice