Dataset for CDS PMAIP1 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2R6N9_PMAIP1-      -----cagactgggggctgggggctgtgcagttctcaaccccttg-atcc
A0A452EST2_PMAIP1-      atgcctggaaggagggctcgtaggagcgcccagccgagccccacgcgggt
A0A8C2P9C6_PMAIP1-      ---------aggagggctcgtaggagcgcccagccgagccccacgcgggt
                                   * ***** *  *  * **    *  * ****  *     

A0A8C2R6N9_PMAIP1-      tctgaagaatcctgaagttgagtgtgccattcagttgaggagaattggag
A0A452EST2_PMAIP1-      cccggcagatcctgaagttgagtgtgccattcagttgaggagaattggag
A0A8C2P9C6_PMAIP1-      cccggcagatcctgaagttgagtgtgccattcagttgaggagaattggag
                         * *    ******************************************

A0A8C2R6N9_PMAIP1-      acaaactgaatttccggcagaaacttgtgaatctgatagccaaactcctc
A0A452EST2_PMAIP1-      acaaactgaatttccggcagaaacttgtgaatctgatagccaaactcctc
A0A8C2P9C6_PMAIP1-      acaaactgaatttccggcagaaacttgtgaatctgatagccaaactcctc
                        **************************************************

A0A8C2R6N9_PMAIP1-      cgctcaggaacttga
A0A452EST2_PMAIP1-      cgctcaggaacttga
A0A8C2P9C6_PMAIP1-      cgctcaggaacttga
                        ***************

© 1998-2022Legal notice