Dataset for CDS BBC3 of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A452E3G1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Capra hircus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctcccccgagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgtggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcactgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcgcc
agtgcccagcgccccgggggccctggcgggcggacccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
caacgacaccgcccctcgccctggagggtcctgtacaatctcatcttgggactcctgcccttccccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A8C2RGP9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Capra hircus GN=BBC3 (length=396 residues).
gtgagagccactgcagaggttgcccgggcatgtccgtgccagctgcccagggctttcttctccccctgggtcccccacca
gattcgcggtcctcagccttcactctcgcccgcggagcagcacctggaatcgccagtgcccagcgccccgggggccctgg
cgggcggacccacccaagcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcggcaacgacaccgcccctcgccctggag
ggtcctgtacaatctcatcttgggactcctgcccttccccgggggccgcggagcccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A8C2RGP9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Capra hircus GN=BBC3 (length=876 residues).
atggcccgagcacgccaggagggcagctcccccgagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgtggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggggtggggggaggccgactgggaagtccctcct
ggaatcggactgcagtccgcgagctgcagcccaaggccttttccgggcccggggcaacagctgttttccagccccccacc
ctccccaggtcctcagccttcactctcgcccgcggagcagcacctggaatcgccagtgcccagcgccccgggggccctgg
cgggcggacccacccaagcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcggcaacgacaccgcccctcgccctggag
ggtcctgtacaatctcatcttgggactcctgcccttccccgggggccgcggagcccccgaggtggagcccaattag
© 1998-2022Legal notice