Dataset for CDS BBC3 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2RGP9_BBC3-01      gt----------------gagagccact-----------gcagagg---t
A0A452E3G1_BBC3-01      atggcccgagcacgccaggagggcagctcccccgagcccgtagagggcct
A0A8C2RGP9_BBC3-02      atggcccgagcacgccaggagggcagctcccccgagcccgtagagggcct
                         *                *** **  **           * *****   *

A0A8C2RGP9_BBC3-01      tgcccgggcatgtccgtgc-----------cagctgcccagggcttt---
A0A452E3G1_BBC3-01      ggcccgcgacggcccgcgccccttcccgctcagccgcctggtgccctcgg
A0A8C2RGP9_BBC3-02      ggcccgcgacggcccgcgccccttcccgctcagccgcctggtgccctcgg
                         ***** *   * *** **           **** ***  * **  *   

A0A8C2RGP9_BBC3-01      ---------------------------------cttctccccctg-----
A0A452E3G1_BBC3-01      cggtgtcctgtggcctctgcgaacccggcctgcctgctgcccccgccgcc
A0A8C2RGP9_BBC3-02      cggtgtcctgtggcctctgcgaacccggcctgcctgctgcccccgccgcc
                                                         ** ** **** *     

A0A8C2RGP9_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      cccgccctgctgcccgccgcctacctctgcgcccccaccgccccgcccgc
A0A8C2RGP9_BBC3-02      cccgccctgctgcccgccgcctacctctgcgcccccaccgccccgcccgc
                                                                          

A0A8C2RGP9_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      cgtcact-------------------------------------------
A0A8C2RGP9_BBC3-02      cnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C2RGP9_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A8C2RGP9_BBC3-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C2RGP9_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A8C2RGP9_BBC3-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C2RGP9_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A8C2RGP9_BBC3-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C2RGP9_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A8C2RGP9_BBC3-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngggg
                                                                          

A0A8C2RGP9_BBC3-01      --------------------ggtcccccaccagattcgc-----------
A0A452E3G1_BBC3-01      ---------gccgccctgggggccccccgctggcctggg-----ggtcc-
A0A8C2RGP9_BBC3-02      tggggggaggccgactgggaagtccctc-ctggaatcggactgcagtccg
                                             * *** * *  *  * *            

A0A8C2RGP9_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      ----ccgcagcc--------------ggccccgag---------------
A0A8C2RGP9_BBC3-02      cgagctgcagcccaaggccttttccgggcccggggcaacagctgttttcc
                                                                          

A0A8C2RGP9_BBC3-01      ------------------ggtcctcagccttcactctcgcccgcggagca
A0A452E3G1_BBC3-01      -gcccgcgacccgac---ggtcctcagccttcactctcgcccgcggagca
A0A8C2RGP9_BBC3-02      agccccccaccctccccaggtcctcagccttcactctcgcccgcggagca
                                          ********************************

A0A8C2RGP9_BBC3-01      gcacctggaatcgccagtgcccagcgccccgggggccctggcgggcggac
A0A452E3G1_BBC3-01      gcacctggaatcgccagtgcccagcgccccgggggccctggcgggcggac
A0A8C2RGP9_BBC3-02      gcacctggaatcgccagtgcccagcgccccgggggccctggcgggcggac
                        **************************************************

A0A8C2RGP9_BBC3-01      ccacccaagcggccccgggagtccggggggaggaggagcagtgggcccga
A0A452E3G1_BBC3-01      ccacccaagcggccccgggagtccggggggaggaggagcagtgggcccga
A0A8C2RGP9_BBC3-02      ccacccaagcggccccgggagtccggggggaggaggagcagtgggcccga
                        **************************************************

A0A8C2RGP9_BBC3-01      gagatcggggcccagctgcggcggatggcggacgacctcaacgcgctata
A0A452E3G1_BBC3-01      gagatcggggcccagctgcggcggatggcggacgacctcaacgcgctata
A0A8C2RGP9_BBC3-02      gagatcggggcccagctgcggcggatggcggacgacctcaacgcgctata
                        **************************************************

A0A8C2RGP9_BBC3-01      cgagcggcggagacaagaggagcggcaacgacaccgcccctcgccctgga
A0A452E3G1_BBC3-01      cgagcggcggagacaagaggagcggcaacgacaccgcccctcgccctgga
A0A8C2RGP9_BBC3-02      cgagcggcggagacaagaggagcggcaacgacaccgcccctcgccctgga
                        **************************************************

A0A8C2RGP9_BBC3-01      gggtcctgtacaatctcatcttgggactcctgcccttccccgggggccgc
A0A452E3G1_BBC3-01      gggtcctgtacaatctcatcttgggactcctgcccttccccgggggccgc
A0A8C2RGP9_BBC3-02      gggtcctgtacaatctcatcttgggactcctgcccttccccgggggccgc
                        **************************************************

A0A8C2RGP9_BBC3-01      ggagcccccgaggtggagcccaattag
A0A452E3G1_BBC3-01      ggagcccccgaggtggagcccaattag
A0A8C2RGP9_BBC3-02      ggagcccccgaggtggagcccaattag
                        ***************************

© 1998-2022Legal notice