Dataset for CDS classical BH3-containing proteins of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

16 sequence(s)

>gnl|bcl2dbcds|A0A5F4BVC5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=906 residues).
acacgcccggcggggggccgggccggcggcgcgcgcaggggaacccgtccgggccacccccgcctttacctgttggagcc
tgagcgcgccagccgctgcggcgcggcggggcggggcggggcgtcgggcccgcgcggcggggcgggacctggcgggggcg
gagctcgcggcgattggctgagggcgcggggccgccagtctgagcggagctgcagggctgtgcaggtttcacttcgctcc
gcgcagcctccaggtctgggtcttgcgagagggctccgtcccgcgtcgccgccgccgccgccgccgccaccggattctca
cagtcgccctacgcgccccagcccactgcggccagcatcgccacgggctgctcgctttgccccgctcccgccgccacccc
tttggcgccctttccttggccctcgtcccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagac
caaatggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcc
tcagctcaggcctggggcccctacctctctacagacagaacagcaagacaggagcccggcacccatgagttgtgacaaat
caacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggct
gtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatattaccc
aaggagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttacgactgttacgttacatcg
tccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A5F4BVC5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=396 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatgggtctttttgaataa
>gnl|bcl2dbcds|A0A5F4BVC5_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttacgactgttacgtta
catcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A5F4BVC5_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A5F4BVC5_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=243 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggttagagcaatagaggaaggtgtcgtg
tag
>gnl|bcl2dbcds|A0A5F4BVC5_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=357 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaagcttccatgaggcagtctcaggctgtacctgcagata
tgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatattacccaaggagggtaatg
atgttttatttactacttctcctcacaccctccccctccccacaattttttttctttaaggttactagtaaaaattccat
acttattctggaaatgcaaggtattacctatatgtga
>gnl|bcl2dbcds|A0A5F4CJ04_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=642 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagccaaagcct
gcaaatcagattctggagactttcaagaaacttgccttgctcacttcggaggccagctaccaggatcaggagcctggggt
ag
>gnl|bcl2dbcds|A0A5F4CJ04_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=639 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagccaaagcct
gcaaatcagattctggagactttcaagaaacttgccttgctcacttcgttcgaagaccacaactccccaggatggttag
>gnl|bcl2dbcds|A0A5F4CJ04_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=612 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagcttccagct
agtcccgggaatatcgtgctctggagctcagcaggattgcagctgcctctga
>gnl|bcl2dbcds|A0A5F4CJ04_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=657 residues).
atgggggcccgagaagggttgggctgcgggcgtgtggggggaccatggaggactggagcgccggggtgcgggaacgcggt
gcaggacccttatctaggggagatggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatg
gggagccggggacccagcctgggagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgt
ctgcatctcttccctctcacccactgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccct
cagtccggcctccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacg
ctggctaccggctccctctccctgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaa
catcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacacca
gcaaaaccaaaatcgagtgtggtggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatg
gggcaggtcccaggtga
>gnl|bcl2dbcds|A0A5F4CJ83_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=882 residues).
atgcaggggctgcccgggcatgtccctgtcaggtgctcggggtttccttctggccctgtgggtcccccgtcagatctgtg
ccaagcgcggctagatgtgcctgctccagagtgtgtccccatcagtgggccagttaccaggaacctgttacaggccccag
ggagcgccatggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggtccgcgcccg
tttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgctgcccc
tgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggc
ctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagcacctg
gaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacccaagcagccccgggagtccggggggaggagga
gcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcgggtgagtg
ttgggggaggggtagacggcaggtgggacttcccgcccgggagggggctgcgggcggccccgccagatgtgcggcagctg
ctgcccggcgcggcggggtcgcgctggggacaggcaggtgggatgggcgacgggcccacggacctgccgaagggcccgcg
ccgcggctggcacgacccgggcaagggccgggaccgcctcgagcgccgcggcgcgtccgtggccctcggccgcggggact
ga
>gnl|bcl2dbcds|A0A5F4CJ83_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=723 residues).
atgccctgtgtgactcccaggctgggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccg
tagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgc
gagcccggcctgcccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctc
agccctcactgtcgccggcggaacagcacctggaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacc
caagcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacga
cctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatc
tcatcatgggactcctgcccttacccaggggccgtggagccccggagatggagcccaattaggtgcctgcacccgcccgg
tggacatcagggacttggggggcaggaccctcccacctcctgatgccctggccagcgcgggggactttttctgcaccatg
tag
>gnl|bcl2dbcds|A0A5F4CJ83_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=807 residues).
atgccctgtgtgactcccaggctgggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccg
tagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgc
gagcccggcctgcccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctc
agccctcactgtcgccggcggaacagcacctggaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacc
caagcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacga
cctcaacgcgctgtacgagcggcgggtgagtgttgggggaggggtagacggcaggtgggacttcccgcccgggagggggc
tgcgggcggccccgccagatgtgcggcagctgctgcccggcgcggcggggtcgcgctggggacaggcaggtgggatgggc
gacgggcccacggacctgccgaagggcccgcgccgcggctggcacgacccgggcaagggccgggaccgcctcgagcgccg
cggcgcgtccgtggccctcggccgcggggactgagggcggcgctcggcggagcagctcatatatcccgggctatttatag
ccggtga
>gnl|bcl2dbcds|A0A5F4CR18_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Canis lupus familiaris GN=PMAIP1 (length=162 residues).
ccagcacgggcggctcgggaccagcacggacctgggccgggaggcgcccctaaacaacttagttttgagtgcgagattac
tttagaaaaataccacccatttataaccacaaaaaaaaaaatgataaatatgctctctcaagtcctcagaaatggcaaat
ga
>gnl|bcl2dbcds|Q1PCT2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Canis lupus familiaris GN=PMAIP1 (length=165 residues).
atgcccggccggaaggcgcgcaagagcgcgcagcccggccccacgcgggcccccgaagagctcgaagtggagtgtgccat
tcagctcaggaaatttggagacaaactgaatttccggcagaaacttctgaatctgttatccaaactcttccgctcaggaa
cctga
>gnl|bcl2dbcds|Q45KI9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus familiaris GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcaaataggggcttgggccccagccccac
aggggaccggcccccaagccctggcaagcaccagcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccagccagccgcaaacaccatggaggcgctggggctgagacccggagtcgccacagctcgttccccgcggggaccgac
gaggatgaaggaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgcgcggc
acggcgctacggccgcgagctccgcaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaagagcg
cggggacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccgtcccagtga
© 1998-2020Legal notice