Dataset for CDS classical BH3-containing proteins of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


J9PB65_BMF-04          atgggggcccgagaagggttgggctgcgggcgtgtggggggaccatggag
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         --------------------------------------------------
J9NTK9_BBC3-01         --------------------------------------------------
J9NTK9_BBC3-03         --------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      acacgcccggcggggggccgggccggcggcgcgcgcaggggaacccgtcc
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          gactggagcgccggggtgcgggaacgcggtgcaggacccttatctagggg
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         --------------------------------------------------
J9NTK9_BBC3-01         --------------------------------------------------
J9NTK9_BBC3-03         --------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      gggccacccccgcctttacctgttggagcctgagcgcgccagccgctgcg
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          ag------------------------------------------------
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         --------------------------------------------------
J9NTK9_BBC3-01         --------------------------------------------------
J9NTK9_BBC3-03         --------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      gcgcggcggggcggggcggggcgtcgggcccgcgcggcggggcgggacct
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          --------------------------------------------------
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         --------------------------------------------------
J9NTK9_BBC3-01         --------------------------------------------------
J9NTK9_BBC3-03         --------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      ggcgggggcggagctcgcggcgattggctgagggcgcggggccgccagtc
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          --------------------------------------------------
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         --------------------------------------------------
J9NTK9_BBC3-01         --------------------------------------------------
J9NTK9_BBC3-03         --------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      tgagcggagctgcagggctgtgcaggtttcacttcgctccgcgcagcctc
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          --------------------------------------------------
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         --------------------------------------------------
J9NTK9_BBC3-01         --------------------------------------------------
J9NTK9_BBC3-03         --------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      caggtctgggtcttgcgagagggctccgtcccgcgtcgccgccgccgccg
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          --------------------------------------------------
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         --------------------------------------------------
J9NTK9_BBC3-01         --------------------------------------------------
J9NTK9_BBC3-03         --------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      ccgccgccaccggattctcacagtcgccctacgcgccccagcccactgcg
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          --------------------------------------------------
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         --------------------------------------------------
J9NTK9_BBC3-01         --------------------------------------------------
J9NTK9_BBC3-03         --------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      gccagcatcgccacgggctgctcgctttgccccgctcccgccgccacccc
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          --------------------------------------------------
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         --------------------------------------------------
J9NTK9_BBC3-01         --------------------------------------------------
J9NTK9_BBC3-03         --------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      tttggcgccctttccttggccctcgtcccccccaatgtctgactctgact
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          ---------------------------------at---------------
J9PB65_BMF-03          ---------------------------------at---------------
J9PB65_BMF-02          ---------------------------------at---------------
J9PB65_BMF-01          ---------------------------------at---------------
F1PK10_BAD-01          ---------------------------------at---------------
Q45KI9_BAD-01          ---------------------------------at---------------
J9NTK9_BBC3-02         ---------------------------------at---------------
J9NTK9_BBC3-01         ---------------------------------atgcaggggctgcccgg
J9NTK9_BBC3-03         ---------------------------------at---------------
Q1PCT2_PMAIP1-01       ---------------------------------at---------------
J9NWV6_BCL2L11-06      ---------------------------------at---------------
J9NWV6_BCL2L11-01      ctcggactgagaaacgcaagaaaaaaagaccaaat---------------
J9NWV6_BCL2L11-05      ---------------------------------at---------------
J9NWV6_BCL2L11-04      ---------------------------------at---------------
J9NWV6_BCL2L11-02      ---------------------------------at---------------
J9NWV6_BCL2L11-03      ---------------------------------at---------------
                                                        **               

J9PB65_BMF-04          --------------------------------------------------
J9PB65_BMF-03          --------------------------------------------------
J9PB65_BMF-02          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
F1PK10_BAD-01          -----------------------------------gttcca---gatccc
Q45KI9_BAD-01          -----------------------------------gttcca---gatccc
J9NTK9_BBC3-02         -----------------------------------gccctgtgtgactcc
J9NTK9_BBC3-01         gcatgtccctgtcaggtgctcggggtttccttctggccctgtgggtcccc
J9NTK9_BBC3-03         -----------------------------------gccctgtgtgactcc
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      --------------------------------------------------
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          ---------------------ggag-------------------------
J9PB65_BMF-03          ---------------------ggag-------------------------
J9PB65_BMF-02          ---------------------ggag-------------------------
J9PB65_BMF-01          ---------------------ggag-------------------------
F1PK10_BAD-01          ag-------------------agtt-------------------------
Q45KI9_BAD-01          ag-------------------agtt-------------------------
J9NTK9_BBC3-02         ca-------------------ggct-------------------------
J9NTK9_BBC3-01         cgtcagatctgtgccaagcgcggctagatgtgcctgctccagagtgtgtc
J9NTK9_BBC3-03         ca-------------------ggct-------------------------
Q1PCT2_PMAIP1-01       ---------------------gcc--------------------------
J9NWV6_BCL2L11-06      ---------------------ggca-------------------------
J9NWV6_BCL2L11-01      ---------------------ggca-------------------------
J9NWV6_BCL2L11-05      ---------------------ggca-------------------------
J9NWV6_BCL2L11-04      ---------------------ggca-------------------------
J9NWV6_BCL2L11-02      ---------------------ggca-------------------------
J9NWV6_BCL2L11-03      ---------------------ggca-------------------------
                                                                         

J9PB65_BMF-04          ----------------------------------ccgcctcagtgtgtgg
J9PB65_BMF-03          ----------------------------------ccgcctcagtgtgtgg
J9PB65_BMF-02          ----------------------------------ccgcctcagtgtgtgg
J9PB65_BMF-01          ----------------------------------ccgcctcagtgtgtgg
F1PK10_BAD-01          ----------------------------------tgagcccagtgagcag
Q45KI9_BAD-01          ----------------------------------tgagcccagtgagcag
J9NTK9_BBC3-02         ----------------------------------gggccccagggagcgc
J9NTK9_BBC3-01         cccatcagtgggccagttaccaggaacctgttacaggccccagggagcgc
J9NTK9_BBC3-03         ----------------------------------gggccccagggagcgc
Q1PCT2_PMAIP1-01       -------------------------------------cggcc--------
J9NWV6_BCL2L11-06      ----------------------------------aagcaaccttcagatg
J9NWV6_BCL2L11-01      ----------------------------------aagcaaccttcagatg
J9NWV6_BCL2L11-05      ----------------------------------aagcaaccttcagatg
J9NWV6_BCL2L11-04      ----------------------------------aagcaaccttcagatg
J9NWV6_BCL2L11-02      ----------------------------------aagcaaccttcagatg
J9NWV6_BCL2L11-03      ----------------------------------aagcaaccttcagatg
                                                               *         

J9PB65_BMF-04          aggagctggaggatgatgtgttccagccagaggatggggagccggggacc
J9PB65_BMF-03          aggagctggaggatgatgtgttccagccagaggatggggagccggggacc
J9PB65_BMF-02          aggagctggaggatgatgtgttccagccagaggatggggagccggggacc
J9PB65_BMF-01          aggagctggaggatgatgtgttccagccagaggatggggagccggggacc
F1PK10_BAD-01          gaagactccagccctg-----------caaatag----------------
Q45KI9_BAD-01          gaagactccagccctg-----------caaatag----------------
J9NTK9_BBC3-02         catggcccgagcacgc-----------caggagggcagctccccggagcc
J9NTK9_BBC3-01         catggcccgagcacgc-----------caggagggcagctccccggagcc
J9NTK9_BBC3-03         catggcccgagcacgc-----------caggagggcagctccccggagcc
Q1PCT2_PMAIP1-01       ------------------------------ggaa----------------
J9NWV6_BCL2L11-06      taagttctgagtgtga-----------cagagaa----------------
J9NWV6_BCL2L11-01      taagttctgagtgtga-----------cagagaa----------------
J9NWV6_BCL2L11-05      taagttctgagtgtga-----------cagagaa----------------
J9NWV6_BCL2L11-04      taagttctgagtgtga-----------cagagaa----------------
J9NWV6_BCL2L11-02      taagttctgagtgtga-----------cagagaa----------------
J9NWV6_BCL2L11-03      taagttctgagtgtga-----------cagagaa----------------
                                                                         

J9PB65_BMF-04          ------cagcctgggagcttgctctctgctgacctgtttgcccag-----
J9PB65_BMF-03          ------cagcctgggagcttgctctctgctgacctgtttgcccag-----
J9PB65_BMF-02          ------cagcctgggagcttgctctctgctgacctgtttgcccag-----
J9PB65_BMF-01          ------cagcctgggagcttgctctctgctgacctgtttgcccag-----
F1PK10_BAD-01          ------gggcttgggccccag----------------ccccacaggggac
Q45KI9_BAD-01          ------gggcttgggccccag----------------ccccacaggggac
J9NTK9_BBC3-02         cgtagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcc
J9NTK9_BBC3-01         cgtagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcc
J9NTK9_BBC3-03         cgtagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcc
Q1PCT2_PMAIP1-01       ------gg---cgcgcaagagcg-----------------cgcag-----
J9NWV6_BCL2L11-06      ------gg---tggacaattgcagcctgctgagaggcctcctcag-----
J9NWV6_BCL2L11-01      ------gg---tggacaattgcagcctgctgagaggcctcctcag-----
J9NWV6_BCL2L11-05      ------gg---tggacaattgcagcctgctgagaggcctcctcag-----
J9NWV6_BCL2L11-04      ------gg---tggacaattgcagcctgctgagaggcctcctcag-----
J9NWV6_BCL2L11-02      ------gg---tggacaattgcagcctgctgagaggcctcctcag-----
J9NWV6_BCL2L11-03      ------gg---tggacaattgcagcctgctgagaggcctcctcag-----
                                   *                           * ***     

J9PB65_BMF-04          -agccagctggactgccccctcagccgtctgcatctcttccctctcaccc
J9PB65_BMF-03          -agccagctggactgccccctcagccgtctgcatctcttccctctcaccc
J9PB65_BMF-02          -agccagctggactgccccctcagccgtctgcatctcttccctctcaccc
J9PB65_BMF-01          -agccagctggactgccccctcagccgtctgcatctcttccctctcaccc
F1PK10_BAD-01          cggccccc--------------aagccctggcaagc-------accagca
Q45KI9_BAD-01          cggccccc--------------aagccctggcaagc-------accagca
J9NTK9_BBC3-02         tggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgcc
J9NTK9_BBC3-01         tggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgcc
J9NTK9_BBC3-03         tggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgcc
Q1PCT2_PMAIP1-01       -----ccc--------------ggccccacgcgggc--------------
J9NWV6_BCL2L11-06      -----ctc--------------aggcctg---gggc--------------
J9NWV6_BCL2L11-01      -----ctc--------------aggcctg---gggc--------------
J9NWV6_BCL2L11-05      -----ctc--------------aggcctg---gggc--------------
J9NWV6_BCL2L11-04      -----ctc--------------aggcctg---gggc--------------
J9NWV6_BCL2L11-02      -----ctc--------------aggcctg---gggc--------------
J9NWV6_BCL2L11-03      -----ctc--------------aggcctg---gggc--------------
                              *                 *                        

J9PB65_BMF-04          actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacc
J9PB65_BMF-03          actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacc
J9PB65_BMF-02          actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacc
J9PB65_BMF-01          actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacc
F1PK10_BAD-01          g-----acggccccaggcctcctaggggaagct----------ggtcacc
Q45KI9_BAD-01          g-----acggccccaggcctcctaggggaagct----------ggtcacc
J9NTK9_BBC3-02         gcccctgctgcccctgccctgct---gcccgct----------gcctacc
J9NTK9_BBC3-01         gcccctgctgcccctgccctgct---gcccgct----------gcctacc
J9NTK9_BBC3-03         gcccctgctgcccctgccctgct---gcccgct----------gcctacc
Q1PCT2_PMAIP1-01       -----------cccc---------------g-------------------
J9NWV6_BCL2L11-06      -----------ccctacctctctacagacag-------------------
J9NWV6_BCL2L11-01      -----------ccctacctctctacagacag-------------------
J9NWV6_BCL2L11-05      -----------ccctacctctctacagacag-------------------
J9NWV6_BCL2L11-04      -----------ccctacctctctacagacag-------------------
J9NWV6_BCL2L11-02      -----------ccctacctctctacagacag-------------------
J9NWV6_BCL2L11-03      -----------ccctacctctctacagacag-------------------
                                  **                 *                   

J9PB65_BMF-04          cagaccctcagtccggcc------tccccaagtcagggtgtcatgctgcc
J9PB65_BMF-03          cagaccctcagtccggcc------tccccaagtcagggtgtcatgctgcc
J9PB65_BMF-02          cagaccctcagtccggcc------tccccaagtcagggtgtcatgctgcc
J9PB65_BMF-01          cagaccctcagtccggcc------tccccaagtcagggtgtcatgctgcc
F1PK10_BAD-01          agcagg-----ggcagcc------------agccagccgcaaacacca--
Q45KI9_BAD-01          agcagg-----ggcagcc------------agccagccgcaaacacca--
J9NTK9_BBC3-02         tctgcgcccccaccgccc------------cgcccgccgtcaccgccgcc
J9NTK9_BBC3-01         tctgcgcccccaccgccc------------cgcccgccgtcaccgccgcc
J9NTK9_BBC3-03         tctgcgcccccaccgccc------------cgcccgccgtcaccgccgcc
Q1PCT2_PMAIP1-01       -----------aagagct--------------------------------
J9NWV6_BCL2L11-06      -----------aacagca--------------------------------
J9NWV6_BCL2L11-01      -----------aacagca--------------------------------
J9NWV6_BCL2L11-05      -----------aacagca--------------------------------
J9NWV6_BCL2L11-04      -----------aacagcaaggtaatcctgaaggcgaaggggaccgctgcc
J9NWV6_BCL2L11-02      -----------aacagcaaggtaatcctgaaggcgaaggggaccgctgcc
J9NWV6_BCL2L11-03      -----------aacagcaaggtaatcctgaaggcgaaggggaccgctgcc
                                       *                                 

J9PB65_BMF-04          ttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggct
J9PB65_BMF-03          ttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggct
J9PB65_BMF-02          ttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggct
J9PB65_BMF-01          ttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggct
F1PK10_BAD-01          -tggagg-----cgctggggctgaga---cc--------cggagtcg---
Q45KI9_BAD-01          -tggagg-----cgctggggctgaga---cc--------cggagtcg---
J9NTK9_BBC3-02         ctggggggcccccgct-ggcctgggggtccc--------cgcagccggcc
J9NTK9_BBC3-01         ctggggggcccccgct-ggcctgggggtccc--------cgcagccggcc
J9NTK9_BBC3-03         ctggggggcccccgct-ggcctgggggtccc--------cgcagccggcc
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      --------------------------------------------------
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      cccaaggcagccctcagggcccgctggcccc--------accagccagcc
J9NWV6_BCL2L11-02      cccaaggcagccctcagggcccgctggcccc--------accagccagcc
J9NWV6_BCL2L11-03      cccaaggcagccctcagggcccgctggcccc--------accagccagcc
                                                                         

J9PB65_BMF-04          ac------------------------------------------------
J9PB65_BMF-03          ac------------------------------------------------
J9PB65_BMF-02          ac------------------------------------------------
J9PB65_BMF-01          ac------------------------------------------------
F1PK10_BAD-01          cc------------------------------------------------
Q45KI9_BAD-01          cc------------------------------------------------
J9NTK9_BBC3-02         cc------------------------------------------------
J9NTK9_BBC3-01         cc------------------------------------------------
J9NTK9_BBC3-03         cc------------------------------------------------
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      --------------------------------------------------
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      ccggcccttttgctaccagatccccgcttttcatctttgtgagaagatcc
J9NWV6_BCL2L11-02      ccggcccttttgctaccagatccccgcttttcatctttgtgagaagatcc
J9NWV6_BCL2L11-03      ccggcccttttgctaccagatccccgcttttcatctttgtgagaagatcc
                                                                         

J9PB65_BMF-04          ------------------------------------------------cg
J9PB65_BMF-03          ------------------------------------------------cg
J9PB65_BMF-02          ------------------------------------------------cg
J9PB65_BMF-01          ------------------------------------------------cg
F1PK10_BAD-01          -------------------------------------------------a
Q45KI9_BAD-01          -------------------------------------------------a
J9NTK9_BBC3-02         -------------------------------------------------g
J9NTK9_BBC3-01         -------------------------------------------------g
J9NTK9_BBC3-03         -------------------------------------------------g
Q1PCT2_PMAIP1-01       -------------------------------------------cgaagtg
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      --------------------------------------------agacag
J9NWV6_BCL2L11-05      --------------------------------------------agacag
J9NWV6_BCL2L11-04      tccctgctgtctcgatcctccagtgggtatttctcttttgacacagacag
J9NWV6_BCL2L11-02      tccctgctgtctcgatcctccagtgggtatttctcttttgacacagacag
J9NWV6_BCL2L11-03      tccctgctgtctcgatcctccagtgggtatttctcttttgacacagacag
                                                                         

J9PB65_BMF-04          gctccctctccctgccagtttccctgcaggcttgcctctcctcgagcagc
J9PB65_BMF-03          gctccctctccctgccagtttccctgcaggcttgcctctcctcgagcagc
J9PB65_BMF-02          gctccctctccctgccagtttccctgcaggcttgcctctcctcgagcagc
J9PB65_BMF-01          gctccctctccctgccagtttccctgcaggcttgcctctcctcgagcagc
F1PK10_BAD-01          cagctcgttccccgcgggg-----------accgacgaggatgaaggaa-
Q45KI9_BAD-01          cagctcgttccccgcgggg-----------accgacgaggatgaaggaa-
J9NTK9_BBC3-02         aggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagc
J9NTK9_BBC3-01         aggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagc
J9NTK9_BBC3-03         aggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagc
Q1PCT2_PMAIP1-01       gagtgtgccattca------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      gagcccggcacccatgagt-------------tgtgacaaatcaacacaa
J9NWV6_BCL2L11-05      gagcccggcacccatgagt-------------tgtgacaaatcaacacaa
J9NWV6_BCL2L11-04      gagcccggcacccatgagt-------------tgtgacaaatcaacacaa
J9NWV6_BCL2L11-02      gagcccggcacccatgagt-------------tgtgacaaatcaacacaa
J9NWV6_BCL2L11-03      gagcccggcacccatgagt-------------tgtgacaaatcaacacaa
                                                                         

J9PB65_BMF-04          ccccggaa------------------------------------------
J9PB65_BMF-03          ccccggaa------------------------------------------
J9PB65_BMF-02          ccccggaa------------------------------------------
J9PB65_BMF-01          ccccggaa------------------------------------------
F1PK10_BAD-01          ---tggaggaagaagagctcagc-------------------------cc
Q45KI9_BAD-01          ---tggaggaagaagagctcagc-------------------------cc
J9NTK9_BBC3-02         acctggaatcgccggtgcccagc-------------------------gc
J9NTK9_BBC3-01         acctggaatcgccggtgcccagc-------------------------gc
J9NTK9_BBC3-03         acctggaatcgccggtgcccagc-------------------------gc
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      -----------------------------------------------agc
J9NWV6_BCL2L11-01      accccaagtcctccttgccaggccttcaaccattatctcagtgcaatggc
J9NWV6_BCL2L11-05      accccaagtcctccttgccaggccttcaaccattatctcagtgcaatggt
J9NWV6_BCL2L11-04      accccaagtcctccttgccaggccttcaaccattatctcagtgcaatggc
J9NWV6_BCL2L11-02      accccaagtcctccttgccaggccttcaaccattatctcagtgcaat---
J9NWV6_BCL2L11-03      accccaagtcctccttgccaggccttcaaccattatctcagtgcaatggc
                                                                         

J9PB65_BMF-04          -------gggcagtggc---------------aacatcgagcagaggtac
J9PB65_BMF-03          -------gggcagtggc---------------aacatcgagcagaggtac
J9PB65_BMF-02          -------gggcagtggc---------------aacatcgagcagaggtac
J9PB65_BMF-01          -------gggcagtggc---------------aacatcgagcagaggtac
F1PK10_BAD-01          tttccgggggcgctcgagctcagcgccccccaacc------------tct
Q45KI9_BAD-01          tttccgggggcgctcgagctcagcgccccccaacc------------tct
J9NTK9_BBC3-02         --cccgggggccctggcgggcggtcccacccaagcagccccgggagtccg
J9NTK9_BBC3-01         --cccgggggccctggcgggcggtcccacccaagcagccccgggagtccg
J9NTK9_BBC3-03         --cccgggggccctggcgggcggtcccacccaagcagccccgggagtccg
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      ttccatgaggcagtctcaggctgtacctgcagatatgcgcccggagatat
J9NWV6_BCL2L11-01      ttccatgaggcagtctcaggctgtacctgcagatatgcgcccggagatat
J9NWV6_BCL2L11-05      t-------------------------------------------------
J9NWV6_BCL2L11-04      ttccatgaggcagtctcaggctgtacctgcagatatgcgcccggagatat
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      ttccatgaggcagtctcaggctgtacctgcagatatgcgcccggagatat
                                                                         

J9PB65_BMF-04          agattgcccgaa--------------------------agcttcagtgca
J9PB65_BMF-03          agattgcccgaa--------------------------agcttcagtgca
J9PB65_BMF-02          agattgcccgaa--------------------------agcttcagtgca
J9PB65_BMF-01          agattgcccgaa--------------------------agcttcagtgca
F1PK10_BAD-01          gcgcggcacggcgctacggccgcg--------------agctccgcagga
Q45KI9_BAD-01          gcgcggcacggcgctacggccgcg--------------agctccgcagga
J9NTK9_BBC3-02         gggggaggaggagcagtgggcccgggagatcggggcccagctgcggcgga
J9NTK9_BBC3-01         gggggaggaggagcagtgggcccgggagatcggggcccagctgcggcgga
J9NTK9_BBC3-03         gggggaggaggagcagtgggcccgggagatcggggcccagctgcggcgga
Q1PCT2_PMAIP1-01       -----gctcagg--------------------------aaat--------
J9NWV6_BCL2L11-06      ggattgcacaag--------------------------agttgcggcgta
J9NWV6_BCL2L11-01      ggattgcacaag--------------------------agttgcggcgta
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      ggattgcacaag--------------------------agttgcggcgta
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      ggattgcacaag--------------------------agttgcggcgta
                                                                         

J9PB65_BMF-04          ttgcagaccagttccatcggcttcacatgcagcaa---------------
J9PB65_BMF-03          ttgcagaccagttccatcggcttcacatgcagcaa---------------
J9PB65_BMF-02          ttgcagaccagttccatcggcttcacatgcagcaa---------------
J9PB65_BMF-01          ttgcagaccagttccatcggcttcacatgcagcaa---------------
F1PK10_BAD-01          tgagcgacgagttccagggctccttcaagggac-----------------
Q45KI9_BAD-01          tgagcgacgagttccagggctccttcaagggac-----------------
J9NTK9_BBC3-02         tggcggacgacctcaacgcgctgtacgagcggcggagaca----agagga
J9NTK9_BBC3-01         tggcggacgacctcaacgcgctgtacgagcggcgggtgagtgttggggga
J9NTK9_BBC3-03         tggcggacgacctcaacgcgctgtacgagcggcgggtgagtgttggggga
Q1PCT2_PMAIP1-01       ttggagacaaactga------atttccggca-------------------
J9NWV6_BCL2L11-06      ttggagacgaatttaatgcatattacccaag-------------------
J9NWV6_BCL2L11-01      ttggagacgaatttaatgcatattacccaag-------------------
J9NWV6_BCL2L11-05      -------------------agagcaatagag-------------------
J9NWV6_BCL2L11-04      ttggagacgaatttaatgcatattacccaag-------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      ttggagacgaatttaatgcatattacccaag-------------------
                                                                         

J9PB65_BMF-04          -------------------------caccagcaaaaccaaaatcgagtgt
J9PB65_BMF-03          -------------------------caccagcaaaaccaaaatcgagtgt
J9PB65_BMF-02          -------------------------caccagcaaaaccaaaatcgagtgt
J9PB65_BMF-01          -------------------------caccagcaaaaccaaaatcgagtgt
F1PK10_BAD-01          --------------------ttcctcgccc--gaagagcgcggggacagc
Q45KI9_BAD-01          --------------------ttcctcgccc--gaagagcgcggggacagc
J9NTK9_BBC3-02         gcagcag-cgaca----ccgcccctcaccctggagggtcctgt--acaat
J9NTK9_BBC3-01         ggggtagacggcaggtgggacttcccgcccgggagggggctgcgggcggc
J9NTK9_BBC3-03         ggggtagacggcaggtgggacttcccgcccgggagggggctgcgggcggc
Q1PCT2_PMAIP1-01       --------------------------------gaaa----------cttc
J9NWV6_BCL2L11-06      --------------------------------gagggtaatgatgtttta
J9NWV6_BCL2L11-01      --------------------------------gagg--------gtcttt
J9NWV6_BCL2L11-05      --------------------------------gaag--------gtgtcg
J9NWV6_BCL2L11-04      --------------------------------gagg-------------t
J9NWV6_BCL2L11-02      ----------------------------------gg--------gtcttt
J9NWV6_BCL2L11-03      --------------------------------gagg--------gtcttt
                                                                         

J9PB65_BMF-04          ggtggcagattctcc-----------tcttcctgcacaacctggctttga
J9PB65_BMF-03          ggtggcagattctcc-----------tcttcctgcacaacctggctttga
J9PB65_BMF-02          ggtggcagattctcc-----------tcttcctgcacaacctggctttga
J9PB65_BMF-01          ggtggcagattctcc-----------tcttcctgcacaacctggctttga
F1PK10_BAD-01          gacg-cagatgcgacaaagccccagctggacgcgcgtcatccagtcctg-
Q45KI9_BAD-01          gacg-cagatgcgacaaagccccagctggacgcgcgtcatccagtcctg-
J9NTK9_BBC3-02         ctcatca----tgggactcctgcccttacccaggggccgtggagccccg-
J9NTK9_BBC3-01         cccgccagatgtgcggcagctgc---tgccc-ggcgcggcggggtcgcgc
J9NTK9_BBC3-03         cccgccagatgtgcggcagctgc---tgccc-ggcgcggcggggtcgcgc
Q1PCT2_PMAIP1-01       tgaatctgttatccaaactcttc---cgctca------------------
J9NWV6_BCL2L11-06      tttactacttctcctcacaccct---ccccctccccacaattttttttct
J9NWV6_BCL2L11-01      ttgaataattaccaagcagccga---agcccacccccaaatgattat--c
J9NWV6_BCL2L11-05      tgtag---------------------------------------------
J9NWV6_BCL2L11-04      tagagcaatag---------------------------------------
J9NWV6_BCL2L11-02      ttgaataa------------------------------------------
J9NWV6_BCL2L11-03      ttgaataattaccaagcagccga---agcccacccccaaatgattat--c
                                                                         

J9PB65_BMF-04          atgcagatgagaacaggaatggggcaggtcccaggtga------------
J9PB65_BMF-03          atgcagatgagaacaggaatggggcaggtcccagc---------------
J9PB65_BMF-02          atgcagatgagaacaggaatggggcaggtcccagccaaagcctgcaaatc
J9PB65_BMF-01          atgcagatgagaacaggaatggggcaggtcccagccaaagcctgcaaatc
F1PK10_BAD-01          -------------gtgggatc-----------------------------
Q45KI9_BAD-01          -------------gtgggatc-----------------------------
J9NTK9_BBC3-02         ---------------gagatg------gagcccaattaggtgcct--gca
J9NTK9_BBC3-01         tggggacaggcaggtgggatgggcgacgggcccacggacctgccgaaggg
J9NTK9_BBC3-03         tggggacaggcaggtgggatgggcgacgggcccacggacctgccgaaggg
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      ttaaggttactagtaaaaatt-----------------------------
J9NWV6_BCL2L11-01      ttacgactgttacgttacatc-----------------------------
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      ttacgactgttacgttacatc-----------------------------
                                                                         

J9PB65_BMF-04          --------------------------------------------------
J9PB65_BMF-03          ---ttccagctagtcccgggaa---tatcgtgctctggagctcag---ca
J9PB65_BMF-02          agattctggagactttcaagaaacttgccttgctc----acttcgttcga
J9PB65_BMF-01          agattctggagactttcaagaaacttgccttgctc----acttcg---ga
F1PK10_BAD-01          ------------------ggaacttggggagaggaggctccgccccgt--
Q45KI9_BAD-01          ------------------ggaacttggggagaggaggctccgccccgt--
J9NTK9_BBC3-02         cccgcccggtggacatcagggacttgg---ggggcaggaccctcccac--
J9NTK9_BBC3-01         cccgcgccgcggctggcacgacccgggcaagggccgggaccgcctcgagc
J9NTK9_BBC3-03         cccgcgccgcggctggcacgacccgggcaagggccgggaccgcctcgagc
Q1PCT2_PMAIP1-01       -------------------------ggaacctga----------------
J9NWV6_BCL2L11-06      ------------ccatacttattctggaaatgcaaggtattacctata--
J9NWV6_BCL2L11-01      ------------gtccgcctggtgtggagattgcagtga-----------
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      ------------gtccgcctggtgtggagattgcagtga-----------
                                                                         

J9PB65_BMF-04          --------------------------------------------------
J9PB65_BMF-03          ggattgcagctgcctctga-------------------------------
J9PB65_BMF-02          agaccacaactccccaggat----------ggttag--------------
J9PB65_BMF-01          ggccagcta----ccaggatcaggagcctggggtag--------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
J9NTK9_BBC3-02         ---------ctcctgatgccctggccagcgcgggggact-----------
J9NTK9_BBC3-01         gccgcggcgcgtccgtggccctcggccgc---ggggactga---------
J9NTK9_BBC3-03         gccgcggcgcgtccgtggccctcggccgc---ggggactgagggcggcgc
Q1PCT2_PMAIP1-01       --------------------------------------------------
J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      --------------------------------------------------
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9PB65_BMF-04          --------------------------------------------
J9PB65_BMF-03          --------------------------------------------
J9PB65_BMF-02          --------------------------------------------
J9PB65_BMF-01          --------------------------------------------
F1PK10_BAD-01          ------------------------------------cccagtga
Q45KI9_BAD-01          ------------------------------------cccagtga
J9NTK9_BBC3-02         ---------------------------ttttctgcaccatgtag
J9NTK9_BBC3-01         --------------------------------------------
J9NTK9_BBC3-03         tcggcggagcagctcatatatcccgggctatttatagccggtga
Q1PCT2_PMAIP1-01       --------------------------------------------
J9NWV6_BCL2L11-06      ---------------------------------------tgtga
J9NWV6_BCL2L11-01      --------------------------------------------
J9NWV6_BCL2L11-05      --------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------
                                                                   

© 1998-2020Legal notice