Dataset for CDS classical BH3-containing proteins of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q45KI9_BAD-01          atgttccagatcccagagtttgagcccagtgagcaggaaga-------ct
A0A5F4CJ04_BMF-03      atggagccg-cctcagtgtgtg-----gaggagctggaggatgatgtgtt
A0A5F4CJ04_BMF-01      atggagccg-cctcagtgtgtg-----gaggagctggaggatgatgtgtt
A0A5F4CJ04_BMF-02      atggagccg-cctcagtgtgtg-----gaggagctggaggatgatgtgtt
                       ***   * *  * *** ** **        **** *** **        *

Q45KI9_BAD-01          ccagccctgcaaataggggcttgggccccagc-----------cccacag
A0A5F4CJ04_BMF-03      ccagccagaggatggggagccggggacccagcctgggagcttgctctctg
A0A5F4CJ04_BMF-01      ccagccagaggatggggagccggggacccagcctgggagcttgctctctg
A0A5F4CJ04_BMF-02      ccagccagaggatggggagccggggacccagcctgggagcttgctctctg
                       ******     *   ** **  *** ******           * * * *

Q45KI9_BAD-01          gggaccggc---ccccaagcc--ctggcaagcaccagcagacggccccag
A0A5F4CJ04_BMF-03      ctgacctgtttgcccagagccagctggactgccccctcagccgtctgcat
A0A5F4CJ04_BMF-01      ctgacctgtttgcccagagccagctggactgccccctcagccgtctgcat
A0A5F4CJ04_BMF-02      ctgacctgtttgcccagagccagctggactgccccctcagccgtctgcat
                         **** *    ***  ****  ****   ** **  *** ** *  ** 

Q45KI9_BAD-01          gcctcctaggggaagctggtcaccagcag----------gggcagccagc
A0A5F4CJ04_BMF-03      ctcttc---------cctctcacccactgctgtggccctgggcttcgacc
A0A5F4CJ04_BMF-01      ctcttc---------cctctcacccactgctgtggccctgggcttcgacc
A0A5F4CJ04_BMF-02      ctcttc---------cctctcacccactgctgtggccctgggcttcgacc
                         ** *         *   *****  * *          ****  * * *

Q45KI9_BAD-01          cagccgcaaacaccatggaggcgctggggctgagacccggagt-----cg
A0A5F4CJ04_BMF-03      caccag------ccaggaagacaaggccacccagaccctcagtccggcct
A0A5F4CJ04_BMF-01      caccag------ccaggaagacaaggccacccagaccctcagtccggcct
A0A5F4CJ04_BMF-02      caccag------ccaggaagacaaggccacccagaccctcagtccggcct
                       ** * *      *** * ** *   *   *  ******  ***     * 

Q45KI9_BAD-01          ccacagctcg-----------ttccccgcggg--gaccgacgaggatgaa
A0A5F4CJ04_BMF-03      ccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccag
A0A5F4CJ04_BMF-01      ccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccag
A0A5F4CJ04_BMF-02      ccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccag
                       ** **  **            * **  * ***  ****** ***    * 

Q45KI9_BAD-01          gga-------atgg-------aggaagaagagctcagccctttccggggg
A0A5F4CJ04_BMF-03      cgactcttttatggcaacgctggctaccggctccctctccctgccagttt
A0A5F4CJ04_BMF-01      cgactcttttatggcaacgctggctaccggctccctctccctgccagttt
A0A5F4CJ04_BMF-02      cgactcttttatggcaacgctggctaccggctccctctccctgccagttt
                        **       ****        *  *   *  * *   ** * ** *   

Q45KI9_BAD-01          cgct-cgagctcagcgccccccaa-----cctctgcgcggca--------
A0A5F4CJ04_BMF-03      ccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaac
A0A5F4CJ04_BMF-01      ccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaac
A0A5F4CJ04_BMF-02      ccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaac
                       * ** *  ***   * * ** * *     ** * *   ****        

Q45KI9_BAD-01          ------cggcgctacgg-----ccgcgagctccgcaggatgagcgacgag
A0A5F4CJ04_BMF-03      atcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccag
A0A5F4CJ04_BMF-01      atcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccag
A0A5F4CJ04_BMF-02      atcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccag
                             * * * *** *     ***  **** *   * **    *** **

Q45KI9_BAD-01          ttccagggctccttcaagggacttcctcgcccgaa--------gagcgcg
A0A5F4CJ04_BMF-03      ttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtg
A0A5F4CJ04_BMF-01      ttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtg
A0A5F4CJ04_BMF-02      ttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtg
                       *****  *      ** *   *  *  *  *  **        *** * *

Q45KI9_BAD-01          gggacagc-----------------------------gacgcagatgcg-
A0A5F4CJ04_BMF-03      gtggcagattctcctcttcctgcacaacctggctttgaatgcagatgaga
A0A5F4CJ04_BMF-01      gtggcagattctcctcttcctgcacaacctggctttgaatgcagatgaga
A0A5F4CJ04_BMF-02      gtggcagattctcctcttcctgcacaacctggctttgaatgcagatgaga
                       * * ***                               * ******* * 

Q45KI9_BAD-01          aca----------aagccccagctggacgcgcgtcatccagtcctggtgg
A0A5F4CJ04_BMF-03      acaggaatggggcaggtcccagc------------------ttccagcta
A0A5F4CJ04_BMF-01      acaggaatggggcaggtcccagccaaagcctgcaaatcagattctggaga
A0A5F4CJ04_BMF-02      acaggaatggggcaggtcccagccaaagcctgcaaatcagattctggaga
                       ***          * * ******                  * *  *   

Q45KI9_BAD-01          gatcgga--------------------acttggggagaggaggctccgcc
A0A5F4CJ04_BMF-03      gtcccgggaa---tatcgtgctctggagctcag---cagga----ttgca
A0A5F4CJ04_BMF-01      ctttcaagaaacttgccttgctc----acttcg---gaggc----cagct
A0A5F4CJ04_BMF-02      ctttcaagaaacttgccttgctc----acttcgttcgaaga----ccaca
                                                   **  *    * *        * 

Q45KI9_BAD-01          ccgtcccagtga----------------
A0A5F4CJ04_BMF-03      gctgcctctga-----------------
A0A5F4CJ04_BMF-01      a----ccaggatcaggagcctggggtag
A0A5F4CJ04_BMF-02      actccccaggat----------ggttag
                            *                      

© 1998-2022Legal notice