Dataset for CDS classical BH3-containing proteins of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0TVZ9_BMF-05       --------------------------------------------------
A0A8C0TVZ9_BMF-01       --------------------------------------------------
A0A8C0TVZ9_BMF-02       --------------------------------------------------
A0A8C0TVZ9_BMF-04       atgggggcccgagaagggttgggctgcgggcgtgtggggggaccatggag
A0A8C0TVZ9_BMF-03       --------------------------------------------------
A0A8C0SI24_BAD-01       --------------------------------------------------
A0A8C0SI24_BAD-02       --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
                                                                          

A0A8C0TVZ9_BMF-05       --------------------------------------------------
A0A8C0TVZ9_BMF-01       --------------------------------------------------
A0A8C0TVZ9_BMF-02       --------------------------------------------------
A0A8C0TVZ9_BMF-04       gactggagcgccggggtgcgggaacgcggtgcaggacccttatctagggg
A0A8C0TVZ9_BMF-03       --------------------------------------------------
A0A8C0SI24_BAD-01       --------------------------------------------------
A0A8C0SI24_BAD-02       --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
                                                                          

A0A8C0TVZ9_BMF-05       --atggagccgcctcagtgtgtggag------------------------
A0A8C0TVZ9_BMF-01       --atggagccgcctcagtgtgtggag------------------------
A0A8C0TVZ9_BMF-02       --atggagccgcctcagtgtgtggag------------------------
A0A8C0TVZ9_BMF-04       agatggagccgcctcagtgtgtggag------------------------
A0A8C0TVZ9_BMF-03       --atggagccgcctcagtgtgtggag------------------------
A0A8C0SI24_BAD-01       --atgttccagatcccagagtttgag------------------------
A0A8C0SI24_BAD-02       --atgttccagatcccagagtttgag------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcg
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcg
A0A8C0S6I7_BCL2L11      --atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcg
                                                                          

A0A8C0TVZ9_BMF-05       --------------------------------------------------
A0A8C0TVZ9_BMF-01       --------------------------------------------------
A0A8C0TVZ9_BMF-02       --------------------------------------------------
A0A8C0TVZ9_BMF-04       --------------------------------------------------
A0A8C0TVZ9_BMF-03       --------------------------------------------------
A0A8C0SI24_BAD-01       --------------------------------------------------
A0A8C0SI24_BAD-02       --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      cggggagccctgggctgcccggcggagcgcggcggcggcgggcgggcggc
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      cggggagccctgggctgcccggcggagcgcggcggcggcgggcgggcggc
A0A8C0S6I7_BCL2L11      cggggagccctgggctgcccggcggagcgcggcggcggcgggcgggcggc
                                                                          

A0A8C0TVZ9_BMF-05       --------------------------------------------------
A0A8C0TVZ9_BMF-01       --------------------------------------------------
A0A8C0TVZ9_BMF-02       --------------------------------------------------
A0A8C0TVZ9_BMF-04       --------------------------------------------------
A0A8C0TVZ9_BMF-03       --------------------------------------------------
A0A8C0SI24_BAD-01       --------------------------------------------------
A0A8C0SI24_BAD-02       --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      cggtggtgggctctgcgcggccccgggggctctgaacgcgagtcccgggc
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      cggtggtgggctctgcgcggccccgggggctctgaacgcgagtcccgggc
A0A8C0S6I7_BCL2L11      cggtggtgggctctgcgcggccccgggggctctgaacgcgagtcccgggc
                                                                          

A0A8C0TVZ9_BMF-05       -----------------------------gagctggaggatgatgtgttc
A0A8C0TVZ9_BMF-01       -----------------------------gagctggaggatgatgtgttc
A0A8C0TVZ9_BMF-02       -----------------------------gagctggaggatgatgtgttc
A0A8C0TVZ9_BMF-04       -----------------------------gagctggaggatgatgtgttc
A0A8C0TVZ9_BMF-03       -----------------------------gagctggaggatgatgtgttc
A0A8C0SI24_BAD-01       -----------------------cccagtgagcaggaaga-------ctc
A0A8C0SI24_BAD-02       -----------------------cccagtgagcaggaaga-------ctc
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      tttgtctcccgcgctcccttcgtgctgacggtcagggggc-------tcc
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      tttgtctcccgcgctcccttcgtgctgacggtcagggggc-------tcc
A0A8C0S6I7_BCL2L11      tttgtctcccgcgctcccttcgtgctgacggtcagggggc-------tcc
                                                                          

A0A8C0TVZ9_BMF-05       cagccagaggatggggagccggggacccagcct-----------------
A0A8C0TVZ9_BMF-01       cagccagaggatggggagccggggacccagcct-----------------
A0A8C0TVZ9_BMF-02       cagccagaggatggggagccggggacccagcct-----------------
A0A8C0TVZ9_BMF-04       cagccagaggatggggagccggggacccagcct-----------------
A0A8C0TVZ9_BMF-03       cagccagaggatggggagccggggacccagcct-----------------
A0A8C0SI24_BAD-01       cagccctgcaaataggggcttgggccccagccccacaggggaccggcccc
A0A8C0SI24_BAD-02       cagccctgcaaataggggcttgggccccagccccacaggggaccggcccc
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      gggtcggcgaaggacgcgggcgggacgccgcggggcccgggcccggacgc
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      gggtcggcgaaggacgcgggcgggacgccgcggggcccgggcccggacgc
A0A8C0S6I7_BCL2L11      gggtcggcgaaggacgcgggcgggacgccgcggggcccgggcccggacgc
                                                                          

A0A8C0TVZ9_BMF-05       --------------------------------------gggagcttgctc
A0A8C0TVZ9_BMF-01       --------------------------------------gggagcttgctc
A0A8C0TVZ9_BMF-02       --------------------------------------gggagcttgctc
A0A8C0TVZ9_BMF-04       --------------------------------------gggagcttgctc
A0A8C0TVZ9_BMF-03       --------------------------------------gggagcttgctc
A0A8C0SI24_BAD-01       c-------------------------------------aagccctggcaa
A0A8C0SI24_BAD-02       c-------------------------------------aagccctggcaa
Q1PCT2_PMAIP1-01        --------------------------------------atgcc----cgg
A0A8C0S6I7_BCL2L11      --------------------------------------atggcaaagcaa
A0A8C0S6I7_BCL2L11      gacgatcggaagggaaggggcggacaaaaaaagaccaaatggcaaagcaa
A0A8C0S6I7_BCL2L11      --------------------------------------atggcaaagcaa
A0A8C0S6I7_BCL2L11      --------------------------------------atggcaaagcaa
A0A8C0S6I7_BCL2L11      gacgatcggaagggaaggggcggacaaaaaaagaccaaatggcaaagcaa
A0A8C0S6I7_BCL2L11      gacgatcggaagggaaggggcggacaaaaaaagaccaaatggcaaagcaa
                                                                *      *  

A0A8C0TVZ9_BMF-05       tctgctga--------cctgtttgcccagagccagctggactgccccctc
A0A8C0TVZ9_BMF-01       tctgctga--------cctgtttgcccagagccagctggactgccccctc
A0A8C0TVZ9_BMF-02       tctgctga--------cctgtttgcccagagccagctggactgccccctc
A0A8C0TVZ9_BMF-04       tctgctga--------cctgtttgcccagagccagctggactgccccctc
A0A8C0TVZ9_BMF-03       tctgctga--------cctgtttgcccagagccagctggactgccccctc
A0A8C0SI24_BAD-01       gcaccagcagacggccccaggcctcctaggggaagctggtcaccagcagg
A0A8C0SI24_BAD-02       gcaccagcagacggccccaggcctcctaggggaagctggtcaccagcagg
Q1PCT2_PMAIP1-01        cc---------------------------ggaaggcgc-------gcaag
A0A8C0S6I7_BCL2L11      ccttcagatgtaagttctgagtgtgacagagaaggtgg-------acaat
A0A8C0S6I7_BCL2L11      ccttcagatgtaagttctgagtgtgacagagaaggtgg-------acaat
A0A8C0S6I7_BCL2L11      ccttcagatgtaagttctgagtgtgacagagaaggtgg-------acaat
A0A8C0S6I7_BCL2L11      ccttcagatgtaagttctgagtgtgacagagaaggtgg-------acaat
A0A8C0S6I7_BCL2L11      ccttcagatgtaagttctgagtgtgacagagaaggtgg-------acaat
A0A8C0S6I7_BCL2L11      ccttcagatgtaagttctgagtgtgacagagaaggtgg-------acaat
                         *                            *   *           *   

A0A8C0TVZ9_BMF-05       agccgtctgcatctcttccctctcac-------ccactgctgtggccct-
A0A8C0TVZ9_BMF-01       agccgtctgcatctcttccctctcac-------ccactgctgtggccct-
A0A8C0TVZ9_BMF-02       agccgtctgcatctcttccctctcac-------ccactgctgtggccct-
A0A8C0TVZ9_BMF-04       agccgtctgcatctcttccctctcac-------ccactgctgtggccct-
A0A8C0TVZ9_BMF-03       agccgtctgcatctcttccctctcac-------ccactgctgtggccct-
A0A8C0SI24_BAD-01       ggcagccagccagccgcaaacaccatggaggcgctggggctgagacccg-
A0A8C0SI24_BAD-02       ggcagccagccagccgcaaacaccatggaggcgctggggctgagacccg-
Q1PCT2_PMAIP1-01        agcg------------------------------cgcagcccggccccac
A0A8C0S6I7_BCL2L11      tgcagcctgctga-------------gaggcctcctcagctcaggcctg-
A0A8C0S6I7_BCL2L11      tgcagcctgctga-------------gaggcctcctcagctcaggcctg-
A0A8C0S6I7_BCL2L11      tgcagcctgctga-------------gaggcctcctcagctcaggcctg-
A0A8C0S6I7_BCL2L11      tgcagcctgctga-------------gaggcctcctcagctcaggcctg-
A0A8C0S6I7_BCL2L11      tgcagcctgctga-------------gaggcctcctcagctcaggcctg-
A0A8C0S6I7_BCL2L11      tgcagcctgctga-------------gaggcctcctcagctcaggcctg-
                         **                                   **   * **   

A0A8C0TVZ9_BMF-05       --gggcttcgacccacc-------------------------------ag
A0A8C0TVZ9_BMF-01       --gggcttcgacccacc-------------------------------ag
A0A8C0TVZ9_BMF-02       --gggcttcgacccacc-------------------------------ag
A0A8C0TVZ9_BMF-04       --gggcttcgacccacc-------------------------------ag
A0A8C0TVZ9_BMF-03       --gggcttcgacccacc-------------------------------ag
A0A8C0SI24_BAD-01       --gagtcgccacagctcgttccccgcggggaccgacgaggatgaaggaat
A0A8C0SI24_BAD-02       --gagtcgccacagctcgttccccgcggggaccgacgaggatgaaggaat
Q1PCT2_PMAIP1-01        gcgggccccc----------------------------------------
A0A8C0S6I7_BCL2L11      --gggcccctacctctc--------------------------------t
A0A8C0S6I7_BCL2L11      --gggcccctacctctc--------------------------------t
A0A8C0S6I7_BCL2L11      --gggcccctacctctc--------------------------------t
A0A8C0S6I7_BCL2L11      --gggcccctacctctc--------------------------------t
A0A8C0S6I7_BCL2L11      --gggcccctacctctc--------------------------------t
A0A8C0S6I7_BCL2L11      --gggcccctacctctc--------------------------------t
                          * *   *                                         

A0A8C0TVZ9_BMF-05       ccaggaagacaaggc-----------------------------------
A0A8C0TVZ9_BMF-01       ccaggaagacaaggc-----------------------------------
A0A8C0TVZ9_BMF-02       ccaggaagacaaggc-----------------------------------
A0A8C0TVZ9_BMF-04       ccaggaagacaaggc-----------------------------------
A0A8C0TVZ9_BMF-03       ccaggaagacaaggc-----------------------------------
A0A8C0SI24_BAD-01       ggaggaagaagagct-----------------------------------
A0A8C0SI24_BAD-02       ggaggaagaagagct-----------------------------------
Q1PCT2_PMAIP1-01        -------gaagagct-----------------------------------
A0A8C0S6I7_BCL2L11      acagacagaacagca-----------------------------------
A0A8C0S6I7_BCL2L11      acagacagaacagca-----------------------------------
A0A8C0S6I7_BCL2L11      acagacagaacagca-----------------------------------
A0A8C0S6I7_BCL2L11      acagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgccccc
A0A8C0S6I7_BCL2L11      acagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgccccc
A0A8C0S6I7_BCL2L11      acagacagaacagca-----------------------------------
                               **  **                                     

A0A8C0TVZ9_BMF-05       --------------------------------------------------
A0A8C0TVZ9_BMF-01       --------------------------------------------------
A0A8C0TVZ9_BMF-02       --------------------------------------------------
A0A8C0TVZ9_BMF-04       --------------------------------------------------
A0A8C0TVZ9_BMF-03       --------------------------------------------------
A0A8C0SI24_BAD-01       --------------------------------------------------
A0A8C0SI24_BAD-02       --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      aaggcagccctcagggcccgctggccccaccagccagccccggccctttt
A0A8C0S6I7_BCL2L11      aaggcagccctcagggcccgctggccccaccagccagccccggccctttt
A0A8C0S6I7_BCL2L11      --------------------------------------------------
                                                                          

A0A8C0TVZ9_BMF-05       --------------------------------------------------
A0A8C0TVZ9_BMF-01       --------------------------------------------------
A0A8C0TVZ9_BMF-02       --------------------------------------------------
A0A8C0TVZ9_BMF-04       --------------------------------------------------
A0A8C0TVZ9_BMF-03       --------------------------------------------------
A0A8C0SI24_BAD-01       --------------------------------------------------
A0A8C0SI24_BAD-02       --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      gctaccagatccccgcttttcatctttgtgagaagatcctccctgctgtc
A0A8C0S6I7_BCL2L11      gctaccagatccccgcttttcatctttgtgagaagatcctccctgctgtc
A0A8C0S6I7_BCL2L11      --------------------------------------------------
                                                                          

A0A8C0TVZ9_BMF-05       ---------------------------cacccagaccctcagtccggcct
A0A8C0TVZ9_BMF-01       ---------------------------cacccagaccctcagtccggcct
A0A8C0TVZ9_BMF-02       ---------------------------cacccagaccctcagtccggcct
A0A8C0TVZ9_BMF-04       ---------------------------cacccagaccctcagtccggcct
A0A8C0TVZ9_BMF-03       ---------------------------cacccagaccctcagtccggcct
A0A8C0SI24_BAD-01       ------------------cagccctttccgggggcgctcgagctcagcgc
A0A8C0SI24_BAD-02       ------------------cagccctttccgggggcgctcgagctcagcgc
Q1PCT2_PMAIP1-01        --------------------------------cgaagtggagtgtgccat
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      ---------------------------------agacaggagcccggcac
A0A8C0S6I7_BCL2L11      ---------------------------------agacaggagcccggcac
A0A8C0S6I7_BCL2L11      tcgatcctccagtgggtatttctcttttgacacagacaggagcccggcac
A0A8C0S6I7_BCL2L11      tcgatcctccagtgggtatttctcttttgacacagacaggagcccggcac
A0A8C0S6I7_BCL2L11      ---------------------------------agacaggagcccggcac
                                                                          

A0A8C0TVZ9_BMF-05       ccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccag
A0A8C0TVZ9_BMF-01       ccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccag
A0A8C0TVZ9_BMF-02       ccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccag
A0A8C0TVZ9_BMF-04       ccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccag
A0A8C0TVZ9_BMF-03       ccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccag
A0A8C0SI24_BAD-01       cccccaacctctgcgcgg--------------------------------
A0A8C0SI24_BAD-02       cccccaacctctgcgcgg--------------------------------
Q1PCT2_PMAIP1-01        tca--gct-----cagga--------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      ccatgagt-----tgtga--------------------------------
A0A8C0S6I7_BCL2L11      ccatgagt-----tgtga--------------------------------
A0A8C0S6I7_BCL2L11      ccatgagt-----tgtga--------------------------------
A0A8C0S6I7_BCL2L11      ccatgagt-----tgtga--------------------------------
A0A8C0S6I7_BCL2L11      ccatgagt-----tgtga--------------------------------
                                                                          

A0A8C0TVZ9_BMF-05       cgactcttttatggcaacgctggctaccggctccctctccctgccagttt
A0A8C0TVZ9_BMF-01       cgactcttttatggcaacgctggctaccggctccctctccctgccagttt
A0A8C0TVZ9_BMF-02       cgactcttttatggcaacgctggctaccggctccctctccctgccagttt
A0A8C0TVZ9_BMF-04       cgactcttttatggcaacgctggctaccggctccctctccctgccagttt
A0A8C0TVZ9_BMF-03       cgactcttttatggcaacgctggctaccggctccctctccctgccagttt
A0A8C0SI24_BAD-01       ---------cacggcgctac-ggccgcgagctccgcaggatgagc-----
A0A8C0SI24_BAD-02       ---------cacggcgctac-ggccgcgagctccgcaggatgagc-----
Q1PCT2_PMAIP1-01        ---------aatttggagacaaactg------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      ---------caaatcaacacaaaccccaagtcctccttgccaggccttca
A0A8C0S6I7_BCL2L11      ---------caaatcaacacaaaccccaagtcctccttgccaggccttca
A0A8C0S6I7_BCL2L11      ---------caaatcaacacaaaccccaagtcctccttgccaggccttca
A0A8C0S6I7_BCL2L11      ---------caaatcaacacaaaccccaagtcctccttgccaggccttca
A0A8C0S6I7_BCL2L11      ---------caaatcaacacaaaccccaagtcctccttgccaggccttca
                                                                          

A0A8C0TVZ9_BMF-05       ccctgcaggct-------tgcctctcctcgagcagcccccgg------aa
A0A8C0TVZ9_BMF-01       ccctgcaggct-------tgcctctcctcgagcagcccccgg------aa
A0A8C0TVZ9_BMF-02       ccctgcaggct-------tgcctctcctcgagcagcccccgg------aa
A0A8C0TVZ9_BMF-04       ccctgcaggct-------tgcctctcctcgagcagcccccgg------aa
A0A8C0TVZ9_BMF-03       ccctgcaggct-------tgcctctcctcgagcagcccccgg------aa
A0A8C0SI24_BAD-01       -------gacgagttccagggctccttcaaggtgagcgccggcccccaaa
A0A8C0SI24_BAD-02       -------gacgagttccagggctccttcaagggacttcctcgcccgaaga
Q1PCT2_PMAIP1-01        ---------------------------------aatttccgg--------
A0A8C0S6I7_BCL2L11      -------------------agcttccatgaggcagtctcagg--------
A0A8C0S6I7_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcagg--------
A0A8C0S6I7_BCL2L11      accattatctcagtgcaatggtt---------------------------
A0A8C0S6I7_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcagg--------
A0A8C0S6I7_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcagg--------
A0A8C0S6I7_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcagg--------
                                                                          

A0A8C0TVZ9_BMF-05       gggcagtggcaacatcgagca-----------------------------
A0A8C0TVZ9_BMF-01       gggcagtggcaacatcgagca-----------------------------
A0A8C0TVZ9_BMF-02       gggcagtggcaacatcgagca-----------------------------
A0A8C0TVZ9_BMF-04       gggcagtggcaacatcgagca-----------------------------
A0A8C0TVZ9_BMF-03       gggcagtggcaacatcgagca-----------------------------
A0A8C0SI24_BAD-01       gcatgtcgggaactgtagttccggggccgctcctctccgtcggccctgac
A0A8C0SI24_BAD-02       gcg---cggggacagcgacgcagatgcga---------------------
Q1PCT2_PMAIP1-01        ------cagaaacttctga-------------------------------
A0A8C0S6I7_BCL2L11      ------ctgtacctgcagatatgcgcccg---------------------
A0A8C0S6I7_BCL2L11      ------ctgtacctgcagatatgcgcccg---------------------
A0A8C0S6I7_BCL2L11      ----------------------------a---------------------
A0A8C0S6I7_BCL2L11      ------ctgtacctgcagatatgcgcccg---------------------
A0A8C0S6I7_BCL2L11      ------ctgtacctgcagatatgcgcccg---------------------
A0A8C0S6I7_BCL2L11      ------ctgtacctgcagatatgcgcccg---------------------
                                                                          

A0A8C0TVZ9_BMF-05       ------------------gaggtacagattgcccgaaagcttcagtgcat
A0A8C0TVZ9_BMF-01       ------------------gaggtacagattgcccgaaagcttcagtgcat
A0A8C0TVZ9_BMF-02       ------------------gaggtacagattgcccgaaagcttcagtgcat
A0A8C0TVZ9_BMF-04       ------------------gaggtacagattgcccgaaagcttcagtgcat
A0A8C0TVZ9_BMF-03       ------------------gaggtacagattgcccgaaagcttcagtgcat
A0A8C0SI24_BAD-01       cctgagtcccagggcctgccggtatctgtagtccacaccgtgcgtcagaa
A0A8C0SI24_BAD-02       -caaagccccag-------------ctgga--------cgcgcgtca---
Q1PCT2_PMAIP1-01        -----------------------atctgttatccaaactcttccgctcag
A0A8C0S6I7_BCL2L11      ------------------gagatatggattgcacaagagttgcggcgtat
A0A8C0S6I7_BCL2L11      ------------------gagatatggattgcacaagagttgcggcgtat
A0A8C0S6I7_BCL2L11      ------------------gagcaataga------ggaaggtgtcgtgtag
A0A8C0S6I7_BCL2L11      ------------------gagatatggattgcacaagagttgcggcgtat
A0A8C0S6I7_BCL2L11      ------------------gagatatggattgcacaagagttgcggcgtat
A0A8C0S6I7_BCL2L11      ------------------gagatatggattgcacaagagttgcggcgtat
                                                                          

A0A8C0TVZ9_BMF-05       tgcagaccagttccatcggcttcacatgcagcaagtaggcatgggagctg
A0A8C0TVZ9_BMF-01       tgcagaccagttccatcggcttcacatgcagcaa----------------
A0A8C0TVZ9_BMF-02       tgcagaccagttccatcggcttcacatgcagcaa----------------
A0A8C0TVZ9_BMF-04       tgcagaccagttccatcggcttcacatgcagcaa----------------
A0A8C0TVZ9_BMF-03       tgcagaccagttccatcggcttcacatgcagcaa----------------
A0A8C0SI24_BAD-01       cgttaaaggtcccgagttccccagatcctcgcgg----------------
A0A8C0SI24_BAD-02       -------------------tccag-tcctggtgg----------------
Q1PCT2_PMAIP1-01        -------gaacctga-----------------------------------
A0A8C0S6I7_BCL2L11      tggagacgaatttaatgcatatta-cccaaggag----------------
A0A8C0S6I7_BCL2L11      tggagacgaatttaatgcatatta-cccaaggag----------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      tggagacgaatttaatgcatatta-cccaaggag----------------
A0A8C0S6I7_BCL2L11      tggagacgaatttaatgcatatta-cccaaggag----------------
A0A8C0S6I7_BCL2L11      tggagacgaatttaatgcatatta-cccaaggag----------------
                                                                          

A0A8C0TVZ9_BMF-05       ggagctgggctggggcgggaggagagtcttctggggctggggggtggggg
A0A8C0TVZ9_BMF-01       ---------caccagcaaaaccaaaatc-----------gagtgtggtgg
A0A8C0TVZ9_BMF-02       ---------caccagcaaaaccaaaatc-----------gagtgtggtgg
A0A8C0TVZ9_BMF-04       ---------caccagcaaaaccaaaatc-----------gagtgtggtgg
A0A8C0TVZ9_BMF-03       ---------caccagcaaaaccaaaatc-----------gagtgtggtgg
A0A8C0SI24_BAD-01       ---------------------------------------cgcggagcacg
A0A8C0SI24_BAD-02       ---------------------------------------ga---------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      ---------------------------------------gct--------
A0A8C0S6I7_BCL2L11      ---------------------------------------ggtctttttga
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      ---------------------------------------gttag------
A0A8C0S6I7_BCL2L11      ---------------------------------------ggtaatgatgt
A0A8C0S6I7_BCL2L11      ---------------------------------------ggtaatgatgt
                                                                          

A0A8C0TVZ9_BMF-05       tggaccaggacctgcctcagccactccgtgtctgccgggaccccaagggc
A0A8C0TVZ9_BMF-01       cagatt-----------------ctcc---tcttcctgcac---------
A0A8C0TVZ9_BMF-02       cagatt-----------------ctcc---tcttcctgcac---------
A0A8C0TVZ9_BMF-04       cagatt-----------------ctcc---tcttcctgcac---------
A0A8C0TVZ9_BMF-03       cagatt-----------------ctcc---tcttcctgcac---------
A0A8C0SI24_BAD-01       ctggcatttgtgctcccgggcagtccc----tttcagatatccgggttct
A0A8C0SI24_BAD-02       --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      ataatt---------accaagcagccg----aagcccacccccaaatgat
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      tttatttactacttctcctcacaccct----ccccctccccacaattttt
A0A8C0S6I7_BCL2L11      tttatttactacttctcctcacaccct----ccccctccccacaattttt
                                                                          

A0A8C0TVZ9_BMF-05       atggtcccggggtcttgg-------------cctgggctgctgtggttcc
A0A8C0TVZ9_BMF-01       -----------aacctgg-------------ctttgaatgcagatgagaa
A0A8C0TVZ9_BMF-02       -----------aacctgg-------------ctttgaatgcagatgagaa
A0A8C0TVZ9_BMF-04       -----------aacctgg-------------ctttgaatgcagatgagaa
A0A8C0TVZ9_BMF-03       -----------aacctgg-------------ctttgaatgcagatgagaa
A0A8C0SI24_BAD-01       ttggcttcaacaacttcagaattcctcagttcttggactgccgtcccggc
A0A8C0SI24_BAD-02       ---------------tcggaa----------cttggg-------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      ----------------ggcaa-----------------------------
A0A8C0S6I7_BCL2L11      tatcttacgactgttacgtta-----------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      ----------------agcaa-----------------------------
A0A8C0S6I7_BCL2L11      tttctttaaggttactagtaa-----------------------------
A0A8C0S6I7_BCL2L11      tttctttaaggttactagtaa-----------------------------
                                                                          

A0A8C0TVZ9_BMF-05       ggtgaactgggtgggcccaactgt----------ccgagcactcctgccc
A0A8C0TVZ9_BMF-01       caggaatggggcaggtcccagccaaagcct--------gcaaatcagatt
A0A8C0TVZ9_BMF-02       caggaatggggcaggtcccagcttccagctagtcccgggaatatcgtgct
A0A8C0TVZ9_BMF-04       caggaatggggcaggtcccag-----------------------------
A0A8C0TVZ9_BMF-03       caggaatggggcaggtcccagtgtattcattgctgt-----ttttttgcg
A0A8C0SI24_BAD-01       ttccagaggctgggtctcgggctcttccggggtcctggcgttctctcccc
A0A8C0SI24_BAD-02       ---gagagg---------aggctc--------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
                                                                          

A0A8C0TVZ9_BMF-05       tctcagagctccaagtgggttacctgccgcctctgggctcaggcttctaa
A0A8C0TVZ9_BMF-01       ctggagactttcaagaaacttgcct----------tgctcacttcggtaa
A0A8C0TVZ9_BMF-02       ctggagctcagcagga--------t----------tgcagctgcctctga
A0A8C0TVZ9_BMF-04       ----------------------------------------------gtga
A0A8C0TVZ9_BMF-03       tttgcattttaaaagtgtctctctg----------tgtac------ataa
A0A8C0SI24_BAD-01       gcgcccctggcacagtgtgtctgggacctaat---cagtcccgttcctaa
A0A8C0SI24_BAD-02       -cgcccc-gtcccagtg--------------------------------a
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A8C0S6I7_BCL2L11      -gaattctaacat--------------------------cctacctctga
A0A8C0S6I7_BCL2L11      -catcgtccgcctggtgtggagattgca------------------gtga
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      -tag----------------------------------------------
A0A8C0S6I7_BCL2L11      -aaattccatacttattctggaaatgcaaggt---attacctatatgtga
A0A8C0S6I7_BCL2L11      -aaattccatacttattctggaaatgcaaggt---attacctatatgtga
                                                                          

© 1998-2022Legal notice