Dataset for CDS BCL2L11 of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|J9NWV6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=396 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatgggtctttttgaataa
>gnl|bcl2dbcds|J9NWV6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttacgactgttacgtta
catcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|J9NWV6_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|J9NWV6_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=243 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggttagagcaatagaggaaggtgtcgtg
tag
>gnl|bcl2dbcds|J9NWV6_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=357 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaagcttccatgaggcagtctcaggctgtacctgcagata
tgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatattacccaaggagggtaatg
atgttttatttactacttctcctcacaccctccccctccccacaattttttttctttaaggttactagtaaaaattccat
acttattctggaaatgcaaggtattacctatatgtga
>gnl|bcl2dbcds|J9NWV6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=906 residues).
acacgcccggcggggggccgggccggcggcgcgcgcaggggaacccgtccgggccacccccgcctttacctgttggagcc
tgagcgcgccagccgctgcggcgcggcggggcggggcggggcgtcgggcccgcgcggcggggcgggacctggcgggggcg
gagctcgcggcgattggctgagggcgcggggccgccagtctgagcggagctgcagggctgtgcaggtttcacttcgctcc
gcgcagcctccaggtctgggtcttgcgagagggctccgtcccgcgtcgccgccgccgccgccgccgccaccggattctca
cagtcgccctacgcgccccagcccactgcggccagcatcgccacgggctgctcgctttgccccgctcccgccgccacccc
tttggcgccctttccttggccctcgtcccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagac
caaatggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcc
tcagctcaggcctggggcccctacctctctacagacagaacagcaagacaggagcccggcacccatgagttgtgacaaat
caacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggct
gtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatattaccc
aaggagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttacgactgttacgttacatcg
tccgcctggtgtggagattgcagtga
© 1998-2020Legal notice