Dataset for CDS BCL2L11 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      acacgcccggcggggggccgggccggcggcgcgcgcaggggaacccgtcc
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      gggccacccccgcctttacctgttggagcctgagcgcgccagccgctgcg
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      gcgcggcggggcggggcggggcgtcgggcccgcgcggcggggcgggacct
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      ggcgggggcggagctcgcggcgattggctgagggcgcggggccgccagtc
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      tgagcggagctgcagggctgtgcaggtttcacttcgctccgcgcagcctc
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      caggtctgggtcttgcgagagggctccgtcccgcgtcgccgccgccgccg
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      ccgccgccaccggattctcacagtcgccctacgcgccccagcccactgcg
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      gccagcatcgccacgggctgctcgctttgccccgctcccgccgccacccc
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      tttggcgccctttccttggccctcgtcccccccaatgtctgactctgact
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      --------------------------------------------------
                                                                         

J9NWV6_BCL2L11-06      ---------------------------------atggcaaagcaaccttc
J9NWV6_BCL2L11-01      ctcggactgagaaacgcaagaaaaaaagaccaaatggcaaagcaaccttc
J9NWV6_BCL2L11-05      ---------------------------------atggcaaagcaaccttc
J9NWV6_BCL2L11-04      ---------------------------------atggcaaagcaaccttc
J9NWV6_BCL2L11-02      ---------------------------------atggcaaagcaaccttc
J9NWV6_BCL2L11-03      ---------------------------------atggcaaagcaaccttc
                                                        *****************

J9NWV6_BCL2L11-06      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
J9NWV6_BCL2L11-01      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
J9NWV6_BCL2L11-05      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
J9NWV6_BCL2L11-04      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
J9NWV6_BCL2L11-02      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
J9NWV6_BCL2L11-03      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
                       **************************************************

J9NWV6_BCL2L11-06      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
J9NWV6_BCL2L11-01      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
J9NWV6_BCL2L11-05      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
J9NWV6_BCL2L11-04      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
J9NWV6_BCL2L11-02      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
J9NWV6_BCL2L11-03      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
                       **************************************************

J9NWV6_BCL2L11-06      cagca---------------------------------------------
J9NWV6_BCL2L11-01      cagca---------------------------------------------
J9NWV6_BCL2L11-05      cagca---------------------------------------------
J9NWV6_BCL2L11-04      cagcaaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccc
J9NWV6_BCL2L11-02      cagcaaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccc
J9NWV6_BCL2L11-03      cagcaaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccc
                       *****                                             

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      --------------------------------------------------
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      tcagggcccgctggccccaccagccagccccggcccttttgctaccagat
J9NWV6_BCL2L11-02      tcagggcccgctggccccaccagccagccccggcccttttgctaccagat
J9NWV6_BCL2L11-03      tcagggcccgctggccccaccagccagccccggcccttttgctaccagat
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      --------------------------------------------------
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      ccccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcc
J9NWV6_BCL2L11-02      ccccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcc
J9NWV6_BCL2L11-03      ccccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcc
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      -----------------------agacaggagcccggcacccatgagttg
J9NWV6_BCL2L11-05      -----------------------agacaggagcccggcacccatgagttg
J9NWV6_BCL2L11-04      agtgggtatttctcttttgacacagacaggagcccggcacccatgagttg
J9NWV6_BCL2L11-02      agtgggtatttctcttttgacacagacaggagcccggcacccatgagttg
J9NWV6_BCL2L11-03      agtgggtatttctcttttgacacagacaggagcccggcacccatgagttg
                                                                         

J9NWV6_BCL2L11-06      --------------------------------------------------
J9NWV6_BCL2L11-01      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
J9NWV6_BCL2L11-05      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
J9NWV6_BCL2L11-04      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
J9NWV6_BCL2L11-02      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
J9NWV6_BCL2L11-03      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
                                                                         

J9NWV6_BCL2L11-06      -------------agcttccatgaggcagtctcaggctgtacctgcagat
J9NWV6_BCL2L11-01      atctcagtgcaatggcttccatgaggcagtctcaggctgtacctgcagat
J9NWV6_BCL2L11-05      atctcagtgcaatggtt---------------------------------
J9NWV6_BCL2L11-04      atctcagtgcaatggcttccatgaggcagtctcaggctgtacctgcagat
J9NWV6_BCL2L11-02      atctcagtgcaat-------------------------------------
J9NWV6_BCL2L11-03      atctcagtgcaatggcttccatgaggcagtctcaggctgtacctgcagat
                                                                         

J9NWV6_BCL2L11-06      atgcgcccggagatatggattgcacaagagttgcggcgtattggagacga
J9NWV6_BCL2L11-01      atgcgcccggagatatggattgcacaagagttgcggcgtattggagacga
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      atgcgcccggagatatggattgcacaagagttgcggcgtattggagacga
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      atgcgcccggagatatggattgcacaagagttgcggcgtattggagacga
                                                                         

J9NWV6_BCL2L11-06      atttaatgcatattacccaaggagggtaatgatgttttatttactacttc
J9NWV6_BCL2L11-01      atttaatgcatattacccaaggagg--------gtctttttgaataatta
J9NWV6_BCL2L11-05      ---------agagcaatagaggaag--------gtgtcgtgtag------
J9NWV6_BCL2L11-04      atttaatgcatattacccaaggagg-------------ttagagcaatag
J9NWV6_BCL2L11-02      -----------------------gg--------gtctttttgaataa---
J9NWV6_BCL2L11-03      atttaatgcatattacccaaggagg--------gtctttttgaataatta
                                               *              *  *       

J9NWV6_BCL2L11-06      tcctcacaccctccccctccccacaattttttttctttaaggttactagt
J9NWV6_BCL2L11-01      ccaagcagccgaagcccacccccaaatgattat--cttacgactgttacg
J9NWV6_BCL2L11-05      --------------------------------------------------
J9NWV6_BCL2L11-04      --------------------------------------------------
J9NWV6_BCL2L11-02      --------------------------------------------------
J9NWV6_BCL2L11-03      ccaagcagccgaagcccacccccaaatgattat--cttacgactgttacg
                                                                         

J9NWV6_BCL2L11-06      aaaaattccatacttattctggaaatgcaaggtattacctatatgtga
J9NWV6_BCL2L11-01      ttacatcgtccgcctggtgtggagattgcagtga--------------
J9NWV6_BCL2L11-05      ------------------------------------------------
J9NWV6_BCL2L11-04      ------------------------------------------------
J9NWV6_BCL2L11-02      ------------------------------------------------
J9NWV6_BCL2L11-03      ttacatcgtccgcctggtgtggagattgcagtga--------------
                                                                       

© 1998-2020Legal notice