Dataset for CDS BCL2L11 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      acacgcccggcggggggccgggccggcggcgcgcgcaggggaacccgtcc
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      gggccacccccgcctttacctgttggagcctgagcgcgccagccgctgcg
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      gcgcggcggggcggggcggggcgtcgggcccgcgcggcggggcgggacct
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      ggcgggggcggagctcgcggcgattggctgagggcgcggggccgccagtc
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      tgagcggagctgcagggctgtgcaggtttcacttcgctccgcgcagcctc
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      caggtctgggtcttgcgagagggctccgtcccgcgtcgccgccgccgccg
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      ccgccgccaccggattctcacagtcgccctacgcgccccagcccactgcg
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      gccagcatcgccacgggctgctcgctttgccccgctcccgccgccacccc
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      tttggcgccctttccttggccctcgtcccccccaatgtctgactctgact
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
                                                                          

A0A5F4BVC5_BCL2L11      ---------------------------------atggcaaagcaaccttc
A0A5F4BVC5_BCL2L11      ctcggactgagaaacgcaagaaaaaaagaccaaatggcaaagcaaccttc
A0A5F4BVC5_BCL2L11      ---------------------------------atggcaaagcaaccttc
A0A5F4BVC5_BCL2L11      ---------------------------------atggcaaagcaaccttc
A0A5F4BVC5_BCL2L11      ---------------------------------atggcaaagcaaccttc
A0A5F4BVC5_BCL2L11      ---------------------------------atggcaaagcaaccttc
                                                         *****************

A0A5F4BVC5_BCL2L11      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
A0A5F4BVC5_BCL2L11      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
A0A5F4BVC5_BCL2L11      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
A0A5F4BVC5_BCL2L11      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
A0A5F4BVC5_BCL2L11      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
A0A5F4BVC5_BCL2L11      agatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctg
                        **************************************************

A0A5F4BVC5_BCL2L11      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
A0A5F4BVC5_BCL2L11      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
A0A5F4BVC5_BCL2L11      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
A0A5F4BVC5_BCL2L11      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
A0A5F4BVC5_BCL2L11      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
A0A5F4BVC5_BCL2L11      agaggcctcctcagctcaggcctggggcccctacctctctacagacagaa
                        **************************************************

A0A5F4BVC5_BCL2L11      cagca---------------------------------------------
A0A5F4BVC5_BCL2L11      cagca---------------------------------------------
A0A5F4BVC5_BCL2L11      cagca---------------------------------------------
A0A5F4BVC5_BCL2L11      cagcaaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccc
A0A5F4BVC5_BCL2L11      cagcaaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccc
A0A5F4BVC5_BCL2L11      cagcaaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccc
                        *****                                             

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      tcagggcccgctggccccaccagccagccccggcccttttgctaccagat
A0A5F4BVC5_BCL2L11      tcagggcccgctggccccaccagccagccccggcccttttgctaccagat
A0A5F4BVC5_BCL2L11      tcagggcccgctggccccaccagccagccccggcccttttgctaccagat
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      ccccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcc
A0A5F4BVC5_BCL2L11      ccccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcc
A0A5F4BVC5_BCL2L11      ccccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcc
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      -----------------------agacaggagcccggcacccatgagttg
A0A5F4BVC5_BCL2L11      -----------------------agacaggagcccggcacccatgagttg
A0A5F4BVC5_BCL2L11      agtgggtatttctcttttgacacagacaggagcccggcacccatgagttg
A0A5F4BVC5_BCL2L11      agtgggtatttctcttttgacacagacaggagcccggcacccatgagttg
A0A5F4BVC5_BCL2L11      agtgggtatttctcttttgacacagacaggagcccggcacccatgagttg
                                                                          

A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
A0A5F4BVC5_BCL2L11      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
A0A5F4BVC5_BCL2L11      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
A0A5F4BVC5_BCL2L11      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
A0A5F4BVC5_BCL2L11      tgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccatt
                                                                          

A0A5F4BVC5_BCL2L11      -------------agcttccatgaggcagtctcaggctgtacctgcagat
A0A5F4BVC5_BCL2L11      atctcagtgcaatggcttccatgaggcagtctcaggctgtacctgcagat
A0A5F4BVC5_BCL2L11      atctcagtgcaatggtt---------------------------------
A0A5F4BVC5_BCL2L11      atctcagtgcaatggcttccatgaggcagtctcaggctgtacctgcagat
A0A5F4BVC5_BCL2L11      atctcagtgcaat-------------------------------------
A0A5F4BVC5_BCL2L11      atctcagtgcaatggcttccatgaggcagtctcaggctgtacctgcagat
                                                                          

A0A5F4BVC5_BCL2L11      atgcgcccggagatatggattgcacaagagttgcggcgtattggagacga
A0A5F4BVC5_BCL2L11      atgcgcccggagatatggattgcacaagagttgcggcgtattggagacga
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      atgcgcccggagatatggattgcacaagagttgcggcgtattggagacga
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      atgcgcccggagatatggattgcacaagagttgcggcgtattggagacga
                                                                          

A0A5F4BVC5_BCL2L11      atttaatgcatattacccaaggagggtaatgatgttttatttactacttc
A0A5F4BVC5_BCL2L11      atttaatgcatattacccaaggagg--------gtctttttgaataatta
A0A5F4BVC5_BCL2L11      ---------agagcaatagaggaag--------gtgtcgtgtag------
A0A5F4BVC5_BCL2L11      atttaatgcatattacccaaggagg-------------ttagagcaatag
A0A5F4BVC5_BCL2L11      -----------------------gg--------gtctttttgaataa---
A0A5F4BVC5_BCL2L11      atttaatgcatattacccaaggagg--------gtctttttgaataatta
                                                *              *  *       

A0A5F4BVC5_BCL2L11      tcctcacaccctccccctccccacaattttttttctttaaggttactagt
A0A5F4BVC5_BCL2L11      ccaagcagccgaagcccacccccaaatgattat--cttacgactgttacg
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      --------------------------------------------------
A0A5F4BVC5_BCL2L11      ccaagcagccgaagcccacccccaaatgattat--cttacgactgttacg
                                                                          

A0A5F4BVC5_BCL2L11      aaaaattccatacttattctggaaatgcaaggtattacctatatgtga
A0A5F4BVC5_BCL2L11      ttacatcgtccgcctggtgtggagattgcagtga--------------
A0A5F4BVC5_BCL2L11      ------------------------------------------------
A0A5F4BVC5_BCL2L11      ------------------------------------------------
A0A5F4BVC5_BCL2L11      ------------------------------------------------
A0A5F4BVC5_BCL2L11      ttacatcgtccgcctggtgtggagattgcagtga--------------
                                                                        

© 1998-2022Legal notice