Dataset for CDS BCL2L11 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcg
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcg
A0A8C0S6I7_BCL2L11      atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcg
                                                                          

A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      gggagccctgggctgcccggcggagcgcggcggcggcgggcgggcggccg
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      gggagccctgggctgcccggcggagcgcggcggcggcgggcgggcggccg
A0A8C0S6I7_BCL2L11      gggagccctgggctgcccggcggagcgcggcggcggcgggcgggcggccg
                                                                          

A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      gtggtgggctctgcgcggccccgggggctctgaacgcgagtcccgggctt
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      gtggtgggctctgcgcggccccgggggctctgaacgcgagtcccgggctt
A0A8C0S6I7_BCL2L11      gtggtgggctctgcgcggccccgggggctctgaacgcgagtcccgggctt
                                                                          

A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      tgtctcccgcgctcccttcgtgctgacggtcagggggctccgggtcggcg
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      tgtctcccgcgctcccttcgtgctgacggtcagggggctccgggtcggcg
A0A8C0S6I7_BCL2L11      tgtctcccgcgctcccttcgtgctgacggtcagggggctccgggtcggcg
                                                                          

A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      aaggacgcgggcgggacgccgcggggcccgggcccggacgcgacgatcgg
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      aaggacgcgggcgggacgccgcggggcccgggcccggacgcgacgatcgg
A0A8C0S6I7_BCL2L11      aaggacgcgggcgggacgccgcggggcccgggcccggacgcgacgatcgg
                                                                          

A0A8C0S6I7_BCL2L11      -----------------------------atggcaaagcaaccttcagat
A0A8C0S6I7_BCL2L11      aagggaaggggcggacaaaaaaagaccaaatggcaaagcaaccttcagat
A0A8C0S6I7_BCL2L11      -----------------------------atggcaaagcaaccttcagat
A0A8C0S6I7_BCL2L11      -----------------------------atggcaaagcaaccttcagat
A0A8C0S6I7_BCL2L11      aagggaaggggcggacaaaaaaagaccaaatggcaaagcaaccttcagat
A0A8C0S6I7_BCL2L11      aagggaaggggcggacaaaaaaagaccaaatggcaaagcaaccttcagat
                                                     *********************

A0A8C0S6I7_BCL2L11      gtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagag
A0A8C0S6I7_BCL2L11      gtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagag
A0A8C0S6I7_BCL2L11      gtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagag
A0A8C0S6I7_BCL2L11      gtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagag
A0A8C0S6I7_BCL2L11      gtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagag
A0A8C0S6I7_BCL2L11      gtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagag
                        **************************************************

A0A8C0S6I7_BCL2L11      gcctcctcagctcaggcctggggcccctacctctctacagacagaacagc
A0A8C0S6I7_BCL2L11      gcctcctcagctcaggcctggggcccctacctctctacagacagaacagc
A0A8C0S6I7_BCL2L11      gcctcctcagctcaggcctggggcccctacctctctacagacagaacagc
A0A8C0S6I7_BCL2L11      gcctcctcagctcaggcctggggcccctacctctctacagacagaacagc
A0A8C0S6I7_BCL2L11      gcctcctcagctcaggcctggggcccctacctctctacagacagaacagc
A0A8C0S6I7_BCL2L11      gcctcctcagctcaggcctggggcccctacctctctacagacagaacagc
                        **************************************************

A0A8C0S6I7_BCL2L11      a-------------------------------------------------
A0A8C0S6I7_BCL2L11      a-------------------------------------------------
A0A8C0S6I7_BCL2L11      a-------------------------------------------------
A0A8C0S6I7_BCL2L11      aaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccctcag
A0A8C0S6I7_BCL2L11      aaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccctcag
A0A8C0S6I7_BCL2L11      a-------------------------------------------------
                        *                                                 

A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      ggcccgctggccccaccagccagccccggcccttttgctaccagatcccc
A0A8C0S6I7_BCL2L11      ggcccgctggccccaccagccagccccggcccttttgctaccagatcccc
A0A8C0S6I7_BCL2L11      --------------------------------------------------
                                                                          

A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      gcttttcatctttgtgagaagatcctccctgctgtctcgatcctccagtg
A0A8C0S6I7_BCL2L11      gcttttcatctttgtgagaagatcctccctgctgtctcgatcctccagtg
A0A8C0S6I7_BCL2L11      --------------------------------------------------
                                                                          

A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      -------------------agacaggagcccggcacccatgagttgtgac
A0A8C0S6I7_BCL2L11      -------------------agacaggagcccggcacccatgagttgtgac
A0A8C0S6I7_BCL2L11      ggtatttctcttttgacacagacaggagcccggcacccatgagttgtgac
A0A8C0S6I7_BCL2L11      ggtatttctcttttgacacagacaggagcccggcacccatgagttgtgac
A0A8C0S6I7_BCL2L11      -------------------agacaggagcccggcacccatgagttgtgac
                                                                          

A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      aaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatct
A0A8C0S6I7_BCL2L11      aaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatct
A0A8C0S6I7_BCL2L11      aaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatct
A0A8C0S6I7_BCL2L11      aaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatct
A0A8C0S6I7_BCL2L11      aaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatct
                                                                          

A0A8C0S6I7_BCL2L11      ---------agcttccatgaggcagtctcaggctgtacctgcagatatgc
A0A8C0S6I7_BCL2L11      cagtgcaatggcttccatgaggcagtctcaggctgtacctgcagatatgc
A0A8C0S6I7_BCL2L11      cagtgcaatggtt-------------------------------------
A0A8C0S6I7_BCL2L11      cagtgcaatggcttccatgaggcagtctcaggctgtacctgcagatatgc
A0A8C0S6I7_BCL2L11      cagtgcaatggcttccatgaggcagtctcaggctgtacctgcagatatgc
A0A8C0S6I7_BCL2L11      cagtgcaatggcttccatgaggcagtctcaggctgtacctgcagatatgc
                                  * *                                     

A0A8C0S6I7_BCL2L11      gcccggagatatggattgcacaagagttgcggcgtattggagacgaattt
A0A8C0S6I7_BCL2L11      gcccggagatatggattgcacaagagttgcggcgtattggagacgaattt
A0A8C0S6I7_BCL2L11      ----agagcaataga------ggaaggtgtcgtgtag-------------
A0A8C0S6I7_BCL2L11      gcccggagatatggattgcacaagagttgcggcgtattggagacgaattt
A0A8C0S6I7_BCL2L11      gcccggagatatggattgcacaagagttgcggcgtattggagacgaattt
A0A8C0S6I7_BCL2L11      gcccggagatatggattgcacaagagttgcggcgtattggagacgaattt
                             ***  ** **         ** **  * ***              

A0A8C0S6I7_BCL2L11      aatgcatattacccaaggaggctggcaagaattc----------------
A0A8C0S6I7_BCL2L11      aatgcatattacccaaggagggtctttttgaataatt---------acca
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      aatgcatattacccaaggaggttag-------------------------
A0A8C0S6I7_BCL2L11      aatgcatattacccaaggagggtaatgatgttttatttactacttctcct
A0A8C0S6I7_BCL2L11      aatgcatattacccaaggagggtaatgatgttttatttactacttctcct
                                                                          

A0A8C0S6I7_BCL2L11      ---------------------------------------------taaca
A0A8C0S6I7_BCL2L11      agcagccgaagcccacccccaaatgattatcttacgactgttacgttaca
A0A8C0S6I7_BCL2L11      --------------------------------------------------
A0A8C0S6I7_BCL2L11      -------------------------------------------agcaata
A0A8C0S6I7_BCL2L11      cacaccctccccctccccacaattttttttctttaaggttactagtaaaa
A0A8C0S6I7_BCL2L11      cacaccctccccctccccacaattttttttctttaaggttactagtaaaa
                                                                          

A0A8C0S6I7_BCL2L11      tcctacctctga--------------------------------
A0A8C0S6I7_BCL2L11      tcgtccgcctggtgtggagattgcagtga---------------
A0A8C0S6I7_BCL2L11      --------------------------------------------
A0A8C0S6I7_BCL2L11      g-------------------------------------------
A0A8C0S6I7_BCL2L11      attccatacttattctggaaatgcaaggtattacctatatgtga
A0A8C0S6I7_BCL2L11      attccatacttattctggaaatgcaaggtattacctatatgtga
                                                                    

© 1998-2022Legal notice