Dataset for CDS BBC3 of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|J9NTK9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=882 residues).
atgcaggggctgcccgggcatgtccctgtcaggtgctcggggtttccttctggccctgtgggtcccccgtcagatctgtg
ccaagcgcggctagatgtgcctgctccagagtgtgtccccatcagtgggccagttaccaggaacctgttacaggccccag
ggagcgccatggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggtccgcgcccg
tttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgctgcccc
tgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggc
ctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagcacctg
gaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacccaagcagccccgggagtccggggggaggagga
gcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcgggtgagtg
ttgggggaggggtagacggcaggtgggacttcccgcccgggagggggctgcgggcggccccgccagatgtgcggcagctg
ctgcccggcgcggcggggtcgcgctggggacaggcaggtgggatgggcgacgggcccacggacctgccgaagggcccgcg
ccgcggctggcacgacccgggcaagggccgggaccgcctcgagcgccgcggcgcgtccgtggccctcggccgcggggact
ga
>gnl|bcl2dbcds|J9NTK9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=723 residues).
atgccctgtgtgactcccaggctgggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccg
tagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgc
gagcccggcctgcccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctc
agccctcactgtcgccggcggaacagcacctggaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacc
caagcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacga
cctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatc
tcatcatgggactcctgcccttacccaggggccgtggagccccggagatggagcccaattaggtgcctgcacccgcccgg
tggacatcagggacttggggggcaggaccctcccacctcctgatgccctggccagcgcgggggactttttctgcaccatg
tag
>gnl|bcl2dbcds|J9NTK9_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=807 residues).
atgccctgtgtgactcccaggctgggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccg
tagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgc
gagcccggcctgcccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctc
agccctcactgtcgccggcggaacagcacctggaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacc
caagcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacga
cctcaacgcgctgtacgagcggcgggtgagtgttgggggaggggtagacggcaggtgggacttcccgcccgggagggggc
tgcgggcggccccgccagatgtgcggcagctgctgcccggcgcggcggggtcgcgctggggacaggcaggtgggatgggc
gacgggcccacggacctgccgaagggcccgcgccgcggctggcacgacccgggcaagggccgggaccgcctcgagcgccg
cggcgcgtccgtggccctcggccgcggggactgagggcggcgctcggcggagcagctcatatatcccgggctatttatag
ccggtga
© 1998-2020Legal notice