Dataset for CDS BBC3 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


J9NTK9_BBC3-02      at--------------------------------------------------gccctgtg
J9NTK9_BBC3-01      atgcaggggctgcccgggcatgtccctgtcaggtgctcggggtttccttctggccctgtg
J9NTK9_BBC3-03      at--------------------------------------------------gccctgtg
                    **                                                  ********

J9NTK9_BBC3-02      tgactccca-------------------ggct----------------------------
J9NTK9_BBC3-01      ggtcccccgtcagatctgtgccaagcgcggctagatgtgcctgctccagagtgtgtcccc
J9NTK9_BBC3-03      tgactccca-------------------ggct----------------------------
                     * * ***                    ****                            

J9NTK9_BBC3-02      -------------------------------gggccccagggagcgccatggcccgagca
J9NTK9_BBC3-01      atcagtgggccagttaccaggaacctgttacaggccccagggagcgccatggcccgagca
J9NTK9_BBC3-03      -------------------------------gggccccagggagcgccatggcccgagca
                                                    ****************************

J9NTK9_BBC3-02      cgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggtccgcgcccg
J9NTK9_BBC3-01      cgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggtccgcgcccg
J9NTK9_BBC3-03      cgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggtccgcgcccg
                    ************************************************************

J9NTK9_BBC3-02      tttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctg
J9NTK9_BBC3-01      tttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctg
J9NTK9_BBC3-03      tttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctg
                    ************************************************************

J9NTK9_BBC3-02      cccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgcc
J9NTK9_BBC3-01      cccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgcc
J9NTK9_BBC3-03      cccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgcc
                    ************************************************************

J9NTK9_BBC3-02      ccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccgg
J9NTK9_BBC3-01      ccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccgg
J9NTK9_BBC3-03      ccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccgg
                    ************************************************************

J9NTK9_BBC3-02      ccccgaggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagcacctg
J9NTK9_BBC3-01      ccccgaggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagcacctg
J9NTK9_BBC3-03      ccccgaggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagcacctg
                    ************************************************************

J9NTK9_BBC3-02      gaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacccaagcagccccg
J9NTK9_BBC3-01      gaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacccaagcagccccg
J9NTK9_BBC3-03      gaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacccaagcagccccg
                    ************************************************************

J9NTK9_BBC3-02      ggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatg
J9NTK9_BBC3-01      ggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatg
J9NTK9_BBC3-03      ggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatg
                    ************************************************************

J9NTK9_BBC3-02      gcggacgacctcaacgcgctgtacgagcggcggagaca----agaggagcagcag-cgac
J9NTK9_BBC3-01      gcggacgacctcaacgcgctgtacgagcggcgggtgagtgttgggggaggggtagacggc
J9NTK9_BBC3-03      gcggacgacctcaacgcgctgtacgagcggcgggtgagtgttgggggaggggtagacggc
                    *********************************          * ****  * ** ** *

J9NTK9_BBC3-02      a----ccgcccctcaccctggagggtcctgt--acaatctcatca----tgggactcctg
J9NTK9_BBC3-01      aggtgggacttcccgcccgggagggggctgcgggcggccccgccagatgtgcggcagctg
J9NTK9_BBC3-03      aggtgggacttcccgcccgggagggggctgcgggcggccccgccagatgtgcggcagctg
                    *       *  * * *** ******  ***    *   * *  **    ** * *  ***

J9NTK9_BBC3-02      cccttacccaggggccgtggagccccg----------------gagatg------gagcc
J9NTK9_BBC3-01      c---tgccc-ggcgcggcggggtcgcgctggggacaggcaggtgggatgggcgacgggcc
J9NTK9_BBC3-03      c---tgccc-ggcgcggcggggtcgcgctggggacaggcaggtgggatgggcgacgggcc
                    *   * *** ** ** * ** * * **                * ****      * ***

J9NTK9_BBC3-02      caattaggtgcct--gcacccgcccggtggacatcagggacttgg---ggggcaggaccc
J9NTK9_BBC3-01      cacggacctgccgaagggcccgcgccgcggctggcacgacccgggcaagggccgggaccg
J9NTK9_BBC3-03      cacggacctgccgaagggcccgcgccgcggctggcacgacccgggcaagggccgggaccg
                    **   *  ****   *  ***** * * **    ** *  *  **   *** * ***** 

J9NTK9_BBC3-02      tcccac-----------ctcctgatgccctggccagcgcgggggact-------------
J9NTK9_BBC3-01      cctcgagcgccgcggcgcgtccgtggccctcggccgc---ggggactga-----------
J9NTK9_BBC3-03      cctcgagcgccgcggcgcgtccgtggccctcggccgc---ggggactgagggcggcgctc
                     * *             *  * *  ***** * * **   *******             

J9NTK9_BBC3-02      -------------------------ttttctgcaccatgtag
J9NTK9_BBC3-01      ------------------------------------------
J9NTK9_BBC3-03      ggcggagcagctcatatatcccgggctatttatagccggtga
                                                              

© 1998-2020Legal notice