Dataset for CDS classical BH3-containing proteins of organism Callorhinchus milii

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A4W3IWD3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Callorhinchus milii GN=BCL2L11 (length=375 residues).
atgcagtcgtcaaggagtacccagaatatccaattgtcaccggccttcattacaacttgcccattattcaatacgaattt
ttttcgtacaccatattcccctgtttccccatcttcgagaactagcaggttgtccagtggatattttacttttgatgtgg
acatcggactgatggctagacccacgagttgcgacaagtctacgcagactccaagcccaacctgccaagccatctacctt
gcacgtcaagctctggcacaggcaccgcattcacagactcatggtaagaatctccttctttgtatttttcttccatcaat
gactgcatttaacattgaattagacccccgaggtaaaggttttgttattgtatga
>gnl|bcl2dbcds|A0A4W3IWD3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Callorhinchus milii GN=BCL2L11 (length=471 residues).
atgtgttcaggtgtcgtcaaggagtacccaggcatgtcacgaggtgagctttctgggcaaagcgatttccctattaacac
gacatgcgagaatatccaattgtcaccggccttcattacaacttgcccattattcaatacgaatttttttcgtacaccat
attcccctgtttccccatcttcgagaactagcaggttgtccagtggatattttacttttgatgtggacatcggactgatg
gctagacccacgagttgcgacaagtctacgcagactccaagcccaacctgccaagccatctaccttgcacatcacacttc
tttatctctaatatcgacaaataaacagttcttaggtaatcataatcgtgaacttgaaatgatggttatgaggtatagta
aacagtgtgtgaaaggagtacatctgaaaagcacaccatttaattttccagttcttttgaaatcattatag
>gnl|bcl2dbcds|A0A4W3IWD3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Callorhinchus milii GN=BCL2L11 (length=495 residues).
agatgcagtcagtttcagttccacacactgactgacaaaagagaaggtcgtcaaggagtacccagcgatttccctattaa
cacgacatgcgagaatatccaattgtcaccggccttcattacaacttgcccattattcaatacgaatttttttcgtacac
catattcccctgtttccccatcttcgagaactagcaggttgtccagtggatattttacttttgatgtggacatcggactg
atggctagacccacgagttgcgacaagtctacgcagactccaagcccaacctgccaagccatctaccttgcacgtcaagc
tctggcacaggcaccattagatcacacttctttatctctaatgtcggtaaatttcttaggtaatcataatcgtgaacttg
aaatgatggttatgaggtatagtaaacagtgtgtgaaaggagtacatctgaaaagcacaccatttaattttccagttctt
ttgaaatcattatag
>gnl|bcl2dbcds|A0A4W3JXA1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Callorhinchus milii GN=BMF (length=600 residues).
atggatctgtctgacactgaagagctggacagtgacgacgaagtctttgcccaggacctgacggcccccgacagcggcta
cagcgacaacacctctggcacccacgagtctctgacgtggcgtgccacacgctcgcggctgcgctctccgataaactcgg
tccacttctgcggccccggatgcggtcggcaggtgcagtgtgacaaggccacccagacccccacctctatccccgggtca
gacctcgcagagcccagcttaccaggcggagttggagcacaccctcgaagactgttttatgggaatgcaggatatcggct
gggttctccggaggtgtttgaagtgccacggtccagtggcctcccccatcaaggccgaggggatggaatgccaatggagc
tgcagcctgaggacagagtggaggtcgggattggccggaagctgcagcagatcggggaccagtttcacagctcctgcatg
gagaggcatcacaggatggaaaaccacgtggaccagccattctggtggagacttcttgtcctcctctttgctatgatctt
tgacccagaagagaatagggcaatgccaggtcaaagatga
© 1998-2020Legal notice