Dataset for CDS classical BH3-containing proteins of organism Callorhinchus milii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W3JXA1_BMF-01       --atggatctgtct--------------------------------gaca
A0A4W3IWD3_BCL2L11      --atgca---------------------------------------gtcg
A0A4W3IWD3_BCL2L11      --atgtgttcaggt--------------------------------gtcg
A0A4W3IWD3_BCL2L11      agatgcagtcagtttcagttccacacactgactgacaaaagagaaggtcg
                          ***                                         * * 

A0A4W3JXA1_BMF-01       ctgaagagc-------------------tggacagtgacgacgaagtctt
A0A4W3IWD3_BCL2L11      tcaaggagtaccc-------------------------------------
A0A4W3IWD3_BCL2L11      tcaaggagtacccaggcatgtcacgaggtgagctttctgggcaaagcgat
A0A4W3IWD3_BCL2L11      tcaaggagtaccc-------------------------------agcgat
                           * ***                                          

A0A4W3JXA1_BMF-01       tgccc-------------------aggacctgacggcccccgacagcggc
A0A4W3IWD3_BCL2L11      ----------------------agaatatccaattgtcaccggc-----c
A0A4W3IWD3_BCL2L11      ttccctattaacacgacatgcgagaatatccaattgtcaccggc-----c
A0A4W3IWD3_BCL2L11      ttccctattaacacgacatgcgagaatatccaattgtcaccggc-----c
                                                *  * *  *  * * *** *     *

A0A4W3JXA1_BMF-01       tacagcgacaacacctctggcaccc---acgagtctctgacgtggcgtgc
A0A4W3IWD3_BCL2L11      ttca-ttacaacttgcccattattcaatacgaatttttttcgt---acac
A0A4W3IWD3_BCL2L11      ttca-ttacaacttgcccattattcaatacgaatttttttcgt---acac
A0A4W3IWD3_BCL2L11      ttca-ttacaacttgcccattattcaatacgaatttttttcgt---acac
                        * **   *****    *    *  *   **** * * *  ***      *

A0A4W3JXA1_BMF-01       cacacgctcgcggctgcgc-tctccgataaactcg------gtccact--
A0A4W3IWD3_BCL2L11      catattcccctgtttccccatcttcga-gaactagcaggttgtccagtgg
A0A4W3IWD3_BCL2L11      catattcccctgtttccccatcttcga-gaactagcaggttgtccagtgg
A0A4W3IWD3_BCL2L11      catattcccctgtttccccatcttcga-gaactagcaggttgtccagtgg
                        ** *  * *  *  * * * *** ***  **** *      ***** *  

A0A4W3JXA1_BMF-01       -tctgcggccccggatgcggtcggcag----------------gtgcagt
A0A4W3IWD3_BCL2L11      atattttacttttgatgtggacatcggactgatggctagacccacgagtt
A0A4W3IWD3_BCL2L11      atattttacttttgatgtggacatcggactgatggctagacccacgagtt
A0A4W3IWD3_BCL2L11      atattttacttttgatgtggacatcggactgatggctagacccacgagtt
                         * *    *    **** ** *  * *                  *   *

A0A4W3JXA1_BMF-01       gtgacaaggccacccagacccccacctctatcc-ccgggtca--gacctc
A0A4W3IWD3_BCL2L11      gcgacaagtctacgcagactccaagcccaacctgccaagccatctacctt
A0A4W3IWD3_BCL2L11      gcgacaagtctacgcagactccaagcccaacctgccaagccatctacctt
A0A4W3IWD3_BCL2L11      gcgacaagtctacgcagactccaagcccaacctgccaagccatctacctt
                        * ****** * ** ***** ** * * * * *  **  * **   **** 

A0A4W3JXA1_BMF-01       gcagagcccagctt---accaggcggagttggagcacaccctcgaaga--
A0A4W3IWD3_BCL2L11      gca-cgtcaagctctggcacaggcaccgca--ttcacagactcatggtaa
A0A4W3IWD3_BCL2L11      gca-c---------------------------atcaca------------
A0A4W3IWD3_BCL2L11      gca-cgtcaagctctggcacaggcaccattagatcaca------------
                        ***                               ****            

A0A4W3JXA1_BMF-01       -------ctgttttatgggaatgcaggatatcggctggg------ttctc
A0A4W3IWD3_BCL2L11      gaatctccttcttt------gtattt-------------------ttctt
A0A4W3IWD3_BCL2L11      -------cttcttt------atctctaatatcgacaaataaacagttctt
A0A4W3IWD3_BCL2L11      -------cttcttt------atctctaatgtcggtaaat------ttctt
                               **  ***       *                       **** 

A0A4W3JXA1_BMF-01       cggaggtgtttgaagtgccacggtccagtggcctcccccatcaaggccga
A0A4W3IWD3_BCL2L11      cca---------------------------------tcaatgactgcatt
A0A4W3IWD3_BCL2L11      agg---------------------------------t-aatcataatcgt
A0A4W3IWD3_BCL2L11      agg---------------------------------t-aatcataatcgt
                                                               ** *       

A0A4W3JXA1_BMF-01       ggggatggaatgccaatggagctgcagcctgaggacagagtggaggtcgg
A0A4W3IWD3_BCL2L11      taacattgaatta-------------------------------------
A0A4W3IWD3_BCL2L11      gaacttgaaatga-------------------------------------
A0A4W3IWD3_BCL2L11      gaacttgaaatga-------------------------------------
                             *  ***                                       

A0A4W3JXA1_BMF-01       gattggccggaagctgcagcagatcggggaccagtttcacagctcctgca
A0A4W3IWD3_BCL2L11      ---gacccccgaggt-----------------a-----------------
A0A4W3IWD3_BCL2L11      ---tggttatgaggtatagtaaacagtgtgtga-----------------
A0A4W3IWD3_BCL2L11      ---tggttatgaggtatagtaaacagtgtgtga-----------------
                                   ** *                 *                 

A0A4W3JXA1_BMF-01       tggagaggcatcacaggatggaaaaccacgtggaccagccattctggtgg
A0A4W3IWD3_BCL2L11      --aagg--------------------------------------t-----
A0A4W3IWD3_BCL2L11      --aaggagtacatctgaaaagcacaccatttaattttccagttct-----
A0A4W3IWD3_BCL2L11      --aaggagtacatctgaaaagcacaccatttaattttccagttct-----
                           **                                       *     

A0A4W3JXA1_BMF-01       agacttcttgtcctcctctttgctatgatctttgacccagaagagaatag
A0A4W3IWD3_BCL2L11      ------------------tttgttattg-t--------------------
A0A4W3IWD3_BCL2L11      ------------------tttgaaatcatt--------------------
A0A4W3IWD3_BCL2L11      ------------------tttgaaatcatt--------------------
                                          ****  **                        

A0A4W3JXA1_BMF-01       ggcaatgccaggtcaaagatga
A0A4W3IWD3_BCL2L11      ------------------atga
A0A4W3IWD3_BCL2L11      ------------------atag
A0A4W3IWD3_BCL2L11      ------------------atag

© 1998-2022Legal notice