Dataset for CDS classical BH3-containing proteins of organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=705 residues).
atgttcccggcggctgcgacccgggccgcgagggccagaggggcagcgcgcggagccgtcggctgcccggcggagcgcag
cggcgggctggccggaaggcgtgggctctgtgctgcgccggggactctgaacccgagtcccgggctttgtctcctgcatt
gtcttcgtggtgacggtcaggggccgccgggtcggcgaaaggcgcgggtcggacgccgtggtgccccgtcccgggccaga
acgctgcgctctgaagggaaggctcggacaaaaagagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagagacctccccagctcagacctggggcccctacctccctacagacagagc
cacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccac
tatctcagtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaaga
gttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtatttttgaataattaccaagcagctgaagacc
acccacacatggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=558 residues).
atgcccgcgcgtgtgtgtgcaccagtttcacaagctgttgacattgttactgtcttttgtttggggttacgaagtttagt
cccaccctctaccaaacaaaaattatgtctttattattttagaaaaagagaccaaatggcaaagcaaccttccgatgtaa
gttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctccccagctcagacctggggcccctacctcc
ctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgcca
ggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcgcccggagatat
ggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtatttttgaataattaccaa
gcagctgaagaccacccacacatggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2R8MW85_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Callithrix jacchus GN=BBC3 (length=1263 residues).
aggaagccgcccgccctccaccgccgccccctccggcgtgttcatgcccccggggtgagtgtgcgcgccctgaatcctcg
ccggcggcgatcggccaggccgggtgggctccctggaggaggtgacaggagtgcaggcggcgagcagtgcgggcgccctg
cctccccacactgcgcctccccacaaaccccacgagggaccctgggctggggtcgcggggagggaggcggctcggcgttg
gggcgcctggtctgggcgcacaggtgcctcggcggtctggcgggtttgtttacaaacaatggggtgcgggctcggcagcg
ccccctggcggccagtgcgaccccggggaagagggtcgaccccggggtgccccagcccccaaagtcagggaggggcgggg
gggcggcacggaggggcggccacacccagggcgcgcgcccgctgggggcggcgacagggggcggctcgcgggccgtggag
tctgcggctcctgcgggcgggggctgcgccccagcaacagccggttattggccccgcgctcgcctggcgggcggggcggg
cgcacgtggcggcggtgggggtggctgtgacagcggagtggggcgtctgggaccgccgtgggagcgcgcgtgtgcggggt
tgtggatctgcaggtgtctcgcctgggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagccc
gtagagggcttggcccgcgacggcccgcgccccttcccgcttggccgcctggtgccctcggccgtgtcctgcggcctctg
cgagtccggcctgcccgccacccccgccgcccccgccttgctgcccgctgcctacctctgcgcccccgccgccccacccg
ccgtcaccgccgccctggggggcccccgctggcctgggggcccccgcagccgcccccgaggcccgcgcccggacggtcct
cagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctggcgggcggtcccac
ccaggcggcccccggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcgacggatggcggacg
acctcaacgcgctgtacgagcggcggagacaagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaat
ctcatcatgggactcctgccctttcccaggggccacagagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A2R8MW85_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Callithrix jacchus GN=BBC3 (length=396 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggtcccctgcca
gatgtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctgg
cgggcggtcccacccaggcggcccccggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcga
cggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcagccgcagcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagccccggagatggagcccaattag
>gnl|bcl2dbcds|F7FUT7_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Callithrix jacchus GN=BIK (length=831 residues).
atggaaacccctgagtgcgcgcccgtctcgggcgcagggaaaacagcgacgcacgagacaaagcaagtttgcagaacagc
agggggcagagaggccgtaaacaagccaaccggccgcacttgtagcggttctgttgctaatgccattcagaccccagtcc
agcattccgcgctcggggtgcgagaggcagctcccggggcggggcggcgcggggcgggacccgggcggggcggggcgtcc
cggtccattaggtcccgcgcgggtccccgggccgcagacacgacgcctctcggctgggtcgcagactctgctatcatcgc
cgccaccgccgccgccgccgccgccgccgccgccagaggagaaatgtctgaagtaagacccctctccagtgacatcttca
tggagaccctcctgtgtgagcagttcgtggatcccctgaccatggaggttgttggtgggagtgaccctgaagaggacctg
gaccctgtggaggaccctttggaatgcatggagaacagtgacgcactggccctgcagctggcctgcatcgcggaccagat
ggatgtgagcctcagggcccggaggctggcccagctctacgaggtggccatgtacagcccgggtctcgctttcgtcctcg
accggaccgacatcggggatgttcttagcggtgtcgtggatgttttcgctaacttccaggaggacatagtgaggctctgg
agatccctgagctccgggtcctgggtgtcccgcaaacaggcagtgctgctagcactcctggcgctgctgctggcgatgtt
cagtgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|F7FUT7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Callithrix jacchus GN=BIK (length=675 residues).
atgccccagggcgcagttaggcactacccgtccccgcggggcaggctgccgccccccacccctcccggaacctttctgat
ttatctctccttggtgggtctctggggtccgtctcagcaggtctgccggtgggccccctgcccccaattctctcccggtc
ccgccccgctcttgctgtccgggagcccgcgaccggagggaggagaaatgtctgaagtaagacccctctccagtgacatc
ttcatggagaccctcctgtgtgagcagttcgtggatcccctgaccatggaggttgttggtgggagtgaccctgaagagga
cctggaccctgtggaggaccctttggaatgcatggagaacagtgacgcactggccctgcagctggcctgcatcgcggacc
agatggatgtgagcctcagggcccggaggctggcccagctctacgaggtggccatgtacagcccgggtctcgctttcgtc
ctcgaccggaccgacatcggggatgttcttagcggtgtcgtggatgttttcgctaacttccaggaggacatagtgaggct
ctggagatccctgagctccgggtcctgggtgtcccgcaaacaggcagtgctgctagcactcctggcgctgctgctggcga
tgttcagtgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|F7GW45_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Callithrix jacchus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagagcgcgcaaccgagccccgcgcgggctccagcagaccttgaagtcgagtgtgccac
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|U3E722_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Callithrix jacchus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtttgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2020Legal notice