Dataset for CDS classical BH3-containing proteins of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      aggaagccgcccgccctccaccgccgccccctccggcgtgttcatgcccc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      cggggtgagtgtgcgcgccctgaatcctcgccggcggcgatcggccaggc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      cgggtgggctccctggaggaggtgacaggagtgcaggcggcgagcagtgc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      gggcgccctgcctccccacactgcgcctccccacaaaccccacgagggac
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      cctgggctggggtcgcggggagggaggcggctcggcgttggggcgcctgg
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        ------------------------------------------------at
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ------------------------------------------------at
A0A2R8M6L7_BCL2L11      ------------------------------------------------at
F7FUT7_BIK-02           ------------------------------------------------at
F7FUT7_BIK-01           ------------------------------------------------at
U3E722_HRK-01           ------------------------------------------------at
A0A2R8MW85_BBC3-03      tctgggcgcacaggtgcctcggcggtctggcgggtttgtttacaaacaat
A0A2R8MW85_BBC3-02      ------------------------------------------------at
                                                                          

F7GW45_PMAIP1-01        g-------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      g----cccgc-------------------------------------gcg
A0A2R8M6L7_BCL2L11      g----ttcccggcggctgcgacccgggccgcgagggccagaggggcagcg
F7FUT7_BIK-02           ggaaacccctgagtgcg--------------------cgcccgtctcggg
F7FUT7_BIK-01           g----ccccagggcgcag-----------ttaggcactacccgtccc---
U3E722_HRK-01           g-------------------------------------------------
A0A2R8MW85_BBC3-03      g---------gggtgcgggctcggcagcgccccctggcggccagtgcgac
A0A2R8MW85_BBC3-02      g---------aaatgtgg--------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tgtgtgtgcaccagtttc--------------------------------
A0A2R8M6L7_BCL2L11      cgcggagccgtcggctgccc------------------------------
F7FUT7_BIK-02           cgcagggaaaacagcgacgcacgagacaaagcaagtttgcagaacagcag
F7FUT7_BIK-01           cgcggggcaggctgccgccc------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      cccggggaagagggtcgaccccggggtgccccagcccccaaagtcaggga
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           ggggcagagaggccgtaaacaagccaaccggccgcacttgtagcggttct
F7FUT7_BIK-01           ---------------------------cccacccctcccggaacctttct
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      ggggcgggggggcggcacggaggggcggccacacccagggcgcgcgcccg
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           gttgctaatgccattcagacccc---------agtccagcattccgcgct
F7FUT7_BIK-01           g---------------------------------------atttatctct
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      ctgggggcggcgacagggggcggctcgcgggccgtggagtctgcggctcc
A0A2R8MW85_BBC3-02      --------------------------------cgtggggtctgc------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           cggggtgcgagaggcagctcccggggcggggcggcgcggggcgggacccg
F7FUT7_BIK-01           c-----------------------------------cttggtgggtctct
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      tgcgggcgggggctgcgccccagcaacagccggttattggccccgcgctc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------acaagctgtt-----gacattgttactgtc
A0A2R8M6L7_BCL2L11      ------ggcggagcgcagcggcgggctggccggaaggcgtgggctctgtg
F7FUT7_BIK-02           ggcggggcggggcgtcccggtccattaggtcccgcgcgggtccccgggcc
F7FUT7_BIK-01           gg-----------ggtccgtctcagcaggtctgccggtgggccccctgcc
U3E722_HRK-01           ----------------------------------------tgcccgtgcc
A0A2R8MW85_BBC3-03      gcctggcgggcggggcgggcgcacgtggcggcggtgggggtggctgtgac
A0A2R8MW85_BBC3-02      ---------------------------------ctgggcatgtccatgcc
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ttttgtttggggt-------------------------------------
A0A2R8M6L7_BCL2L11      ctgcgccggggac-------------------------------------
F7FUT7_BIK-02           gcagacacgacgc-------------------------------------
F7FUT7_BIK-01           cccaattc----t-------------------------------------
U3E722_HRK-01           c-------------------------------------------------
A0A2R8MW85_BBC3-03      agcggagtggggcgtctgggaccgccgtgggagcgcgcgtgtgcggggtt
A0A2R8MW85_BBC3-02      a----agtg-----------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      gtggatctgcaggtgtctcgcctgggccccagggagcgccatggcccgcg
A0A2R8MW85_BBC3-02      ---------------------------cccaggg----------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      cacgccaggagggcagctccccggagcccgtagagggcttggcccgcgac
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      -----------tacgaagtttagtccc-----------------------
A0A2R8M6L7_BCL2L11      -----------tctgaacccgagtcccgggctttgtctcctgcattgtct
F7FUT7_BIK-02           -----------ctctcggctgggtcgc-----------------------
F7FUT7_BIK-01           -----------ctcccggtcccgcc-------------------------
U3E722_HRK-01           -----------cctgcaccgcggccgc-----------------------
A0A2R8MW85_BBC3-03      ggcccgcgccccttcccgcttggccgcctggtgccctcggccgtgtcctg
A0A2R8MW85_BBC3-02      -----------cttcttcctcgg---------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tcgtggtgacggtcaggggccgccgggtcggcgaaaggcgcgggtcggac
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      cggcctctgcgagtccggcctgcccgccacccccgccgcccccgccttgc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------accctctaccaaacaaaaattatgtcttt--------attat
A0A2R8M6L7_BCL2L11      gccgtggtgccccgtcccgggccagaacgctgcgctctgaagggaaggct
F7FUT7_BIK-02           -agactctgctatcatcgccgccaccgccgccgccgccgccgccgccgcc
F7FUT7_BIK-01           ------------------ccgctcttgctgtccgggagcccgcgaccg--
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      tgcccgctgcctacctctgcgcccccgccgccccacccgccgtcaccgcc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      ------------------atggcaaagcaaccttccgatgtaagttctga
A0A2R8M6L7_BCL2L11      tttagaaaaagagaccaaatggcaaagcaaccttccgatgtaagttctga
A0A2R8M6L7_BCL2L11      cggacaaaaagagaccaaatggcaaagcaaccttccgatgtaagttctga
F7FUT7_BIK-02           gccagaggagaaatgtctgaagtaagacccctctccagtgacatcttcat
F7FUT7_BIK-01           gagggaggagaaatgtctgaagtaagacccctctccagtgacatcttcat
U3E722_HRK-01           ------------------------ggccccccggc---------------
A0A2R8MW85_BBC3-03      gccctggg----------------gggcccccgctggcctgggggccccc
A0A2R8MW85_BBC3-02      ----tgtg----------------ggtcccctgccag-------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      gtgtgaccgagaaggtagacaat----------------------tgcag
A0A2R8M6L7_BCL2L11      gtgtgaccgagaaggtagacaat----------------------tgcag
A0A2R8M6L7_BCL2L11      gtgtgaccgagaaggtagacaat----------------------tgcag
F7FUT7_BIK-02           ggagaccctcctgtgtgagcagttcgtggatcccctgaccatggaggttg
F7FUT7_BIK-01           ggagaccctcctgtgtgagcagttcgtggatcccctgaccatggaggttg
U3E722_HRK-01           ------------------------------------------cgtttgcg
A0A2R8MW85_BBC3-03      gcagccgcccccgaggcccgcgcccggacggtcctcagccctcgctctcg
A0A2R8MW85_BBC3-02      -----------------------atgtgtggtcctcagccctcgctctcg
                                                                          

F7GW45_PMAIP1-01        cctgggaagaaggcgcgcaagagc--------------------------
A0A2R8M6L7_BCL2L11      cctgcggagagacctccccagctcagacctggggcccct----acctccc
A0A2R8M6L7_BCL2L11      cctgcggagagacctccccagctcagacctggggcccct----acctccc
A0A2R8M6L7_BCL2L11      cctgcggagagacctccccagctcagacctggggcccct----acctccc
F7FUT7_BIK-02           ttggtgggagtg--accctgaagaggacctggaccctgtggaggaccctt
F7FUT7_BIK-01           ttggtgggagtg--accctgaagaggacctggaccctgtggaggaccctt
U3E722_HRK-01           cctgcagcgcgggtcgcctggggctgcgctcgtcc--------gccgc--
A0A2R8MW85_BBC3-03      ctggcggagcag--cacctggagtcgcccgtgccc--------agcgccc
A0A2R8MW85_BBC3-02      ctggcggagcag--cacctggagtcgcccgtgccc--------agcgccc
                           *             *                                

F7GW45_PMAIP1-01        ---------------gcgcaaccg--------------------------
A0A2R8M6L7_BCL2L11      tacag----------acagagccacaaggtaatcccgaaggcaatcacgg
A0A2R8M6L7_BCL2L11      tacag----------acagagccaca------------------------
A0A2R8M6L7_BCL2L11      tacag----------acagagccaca------------------------
F7FUT7_BIK-02           tggaatgcatggagaacagtgacgca------------------------
F7FUT7_BIK-01           tggaatgcatggagaacagtgacgca------------------------
U3E722_HRK-01           ---------------gcag-ctcacc------------------------
A0A2R8MW85_BBC3-03      caggggccctggcgggcggtcccacc------------------------
A0A2R8MW85_BBC3-02      caggggccctggcgggcggtcccacc------------------------
                                        *     *                           

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      aggtgaaggggacagctgcctccacggcagccctcagggcccgctggccc
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      caccggccagccccggcccttttgctaccagatccccgcttttcatcttt
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      gtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttt
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

F7GW45_PMAIP1-01        -----------------------agccc----------------------
A0A2R8M6L7_BCL2L11      tgacacagacagg----------agcccagcacccatgagttgtgacaaa
A0A2R8M6L7_BCL2L11      ------agacagg----------agcccagcacccatgagttgtgacaaa
A0A2R8M6L7_BCL2L11      ------agacagg----------agcccagcacccatgagttgtgacaaa
F7FUT7_BIK-02           ---------ctggccctgcagctggcctgcatcgcggaccagatggatgt
F7FUT7_BIK-01           ---------ctggccctgcagctggcctgcatcgcggaccagatggatgt
U3E722_HRK-01           ------------gc---------cgccc----------------------
A0A2R8MW85_BBC3-03      ---------caggc---------ggccc---ccggagtccgcggggagga
A0A2R8MW85_BBC3-02      ---------caggc---------ggccc---ccggagtccgcggggagga
                                                ***                       

F7GW45_PMAIP1-01        --cgcgcgggctccagcagaccttgaagtcgag--tgtgccactcaactc
A0A2R8M6L7_BCL2L11      tcaacacaaaccccaa--gtcctccttgccaggccttcaaccactatctc
A0A2R8M6L7_BCL2L11      tcaacacaaaccccaa--gtcctccttgccaggccttcaaccactatctc
A0A2R8M6L7_BCL2L11      tcaacacaaaccccaa--gtcctccttgccaggccttcaaccactatctc
F7FUT7_BIK-02           gagcctcagggcccgg--aggct---ggcccag-ctctacgaggtggcca
F7FUT7_BIK-01           gagcctcagggcccgg--aggct---ggcccag-ctctacgaggtggcca
U3E722_HRK-01           --------ggctcaag--gcgctcggcgacgag-ctgcacc----agc--
A0A2R8MW85_BBC3-03      ggagcagtgggcccgg--gagatcggggcccag-ctgcgacggatggc--
A0A2R8MW85_BBC3-02      ggagcagtgggcccgg--gagatcggggcccag-ctgcgacggatggc--
                                    *         *    * *  *  *           *  

F7GW45_PMAIP1-01        agga-------------gatttggagacaaactgaatttccgg-------
A0A2R8M6L7_BCL2L11      agtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcg
A0A2R8M6L7_BCL2L11      agtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcg
A0A2R8M6L7_BCL2L11      agtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcg
F7FUT7_BIK-02           tgtacagcccgggtctcgctttcgtcctcgaccggaccgacat-------
F7FUT7_BIK-01           tgtacagcccgggtctcgctttcgtcctcgaccggaccgacat-------
U3E722_HRK-01           -gcaccatgtggc---ggc-----------gccgcgc-----g-------
A0A2R8MW85_BBC3-03      -ggacgacctcaa---cgc-----------gctgtacgagcgg-------
A0A2R8MW85_BBC3-02      -ggacgacctcaa---cgc-----------gctgtacgagcgg-------
                         *               *             * *                

F7GW45_PMAIP1-01        ---------------------------------------------cagaa
A0A2R8M6L7_BCL2L11      cccggagatatggatcgcc--------------------------caaga
A0A2R8M6L7_BCL2L11      cccggagatatggatcgcc--------------------------caaga
A0A2R8M6L7_BCL2L11      cccggagatatggatcgcc--------------------------caaga
F7FUT7_BIK-02           --cggggatgttcttagcggtgtcgtggatgttttcgctaacttccagga
F7FUT7_BIK-01           --cggggatgttcttagcggtgtcgtggatgttttcgctaacttccagga
U3E722_HRK-01           --cggagc-------------------------------------cggag
A0A2R8MW85_BBC3-03      --cggaga-------------------------------------caaga
A0A2R8MW85_BBC3-02      --cggaga-------------------------------------caaga
                                                                     *    

F7GW45_PMAIP1-01        ac-----------ttctgaatctgatatccaaactcttctgctcagga--
A0A2R8M6L7_BCL2L11      gt----tgcggcgtatcggagacgagtttaacgcttattatccaaggagg
A0A2R8M6L7_BCL2L11      gt----tgcggcgtatcggagacgagtttaacgcttattatccaaggagg
A0A2R8M6L7_BCL2L11      gt----tgcggcgtatcggagacgagtttaacgcttattatccaaggagg
F7FUT7_BIK-02           ggacatagtgaggctctgga---g-atccctgagctccgggtcctgggtg
F7FUT7_BIK-01           ggacatagtgaggctctgga---g-atccctgagctccgggtcctgggtg
U3E722_HRK-01           gg----cgccggcgcccggc---gcgctccccacctactggccctggctg
A0A2R8MW85_BBC3-03      gg----agcag----ccgca---gcaccgccc-----ctcgccctggagg
A0A2R8MW85_BBC3-02      gg----agcag----ccgca---gcaccgccc-----ctcgccctggagg
                                         *     *                     **   

F7GW45_PMAIP1-01        --------------------------------------------------
A0A2R8M6L7_BCL2L11      tta-----------------------------------------------
A0A2R8M6L7_BCL2L11      gtatttttgaataattaccaagcagctgaagaccacccacacatggttat
A0A2R8M6L7_BCL2L11      gtatttttgaataattaccaagcagctgaagaccacccacacatggttat
F7FUT7_BIK-02           tcc---------cgcaaacaggcagtgctgctagcactcctggcgctgct
F7FUT7_BIK-01           tcc---------cgcaaacaggcagtgctgctagcactcctggcgctgct
U3E722_HRK-01           ----------------------------tgcgcggccgcg-caggtggcg
A0A2R8MW85_BBC3-03      ------------------------gtcctgtacaatctcatcatgggact
A0A2R8MW85_BBC3-02      ------------------------gtcctgtacaatctcatcatgggact
                                                                          

F7GW45_PMAIP1-01        -------------------------------------------acctga
A0A2R8M6L7_BCL2L11      ------------------------------------gagaa---atag-
A0A2R8M6L7_BCL2L11      cttacgactgttacgttacattgtccgcctggtgtggagaatgcattga
A0A2R8M6L7_BCL2L11      cttacgactgttacgttacattgtccgcctggtgtggagaatgcattga
F7FUT7_BIK-02           gctggcgatgttcagtgg------gggtctgcacctgctgctcaagtga
F7FUT7_BIK-01           gctggcgatgttcagtgg------gggtctgcacctgctgctcaagtga
U3E722_HRK-01           gcg--------ctggcggcctggctgctcggcaggcggaacttg--tag
A0A2R8MW85_BBC3-03      cctgccctttcccaggggccacagagccccggagatggagcccaattag
A0A2R8MW85_BBC3-02      cctgccctttcccaggggccacagagccccggagatggagcccaattag
                                                                         

© 1998-2020Legal notice