Dataset for CDS classical BH3-containing proteins of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      atgttcccggcggctgcgacccgggccgcgagggccagaggggcagcgcg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
U3F2S3_BAD-01           --------------------------------------------------
F7HZL0_BMF-01           ------------------------------atgccccgagcgggcgtatt
F7HZL0_BMF-02           --------------------------------------------------
F7HZL0_BMF-03           --------------------------------------------------
                                                                          

U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      cggagccgtcggctgcccggcggagcgcagcggcgggctggccggaaggc
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
U3F2S3_BAD-01           --------------------------------------------------
F7HZL0_BMF-01           ttggaaacaataccgcacggtgcggagtggcctcctcccgccccggcccg
F7HZL0_BMF-02           --------------------------------------------------
F7HZL0_BMF-03           --------------------------------------------------
                                                                          

U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      gtgggctctgtgctgcgccggggactctgaacccgagtcccgggctttgt
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
U3F2S3_BAD-01           --------------------------------------------------
F7HZL0_BMF-01           cgtccgctgtcgccgccgccctttgcctgcgcctcccgcctcccgccgca
F7HZL0_BMF-02           --------------------------------------------------
F7HZL0_BMF-03           --------------------------------------------------
                                                                          

U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ctcctgcattgtcttcgtggtgacggtcaggggccgccgggtcggcgaaa
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
U3F2S3_BAD-01           --------------------------------------------------
F7HZL0_BMF-01           gcccgctgggctttttccctccttcccaatcgagtctgggcatcaagccc
F7HZL0_BMF-02           --------------------------------------------------
F7HZL0_BMF-03           --------------------------------------------------
                                                                          

U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ggcgcgggtcggacgccgtggtgccccgtcccgggccagaacgctgcgct
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
U3F2S3_BAD-01           --------------------------------------------------
F7HZL0_BMF-01           ccgagtgctcgtcacgctggaccctggcgcggagccctggcatcacgact
F7HZL0_BMF-02           --------------------------------------------------
F7HZL0_BMF-03           --------------------------------------------------
                                                                          

U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------atggcaaagcaaccttcc
A0A2R8M6L7_BCL2L11      ctgaagggaaggctcggacaaaaaaagaccaaatggcaaagcaaccttcc
A0A2R8M6L7_BCL2L11      --------------------------------atggcaaagcaaccttcc
A0A2R8M6L7_BCL2L11      --------------------------------atggcaaagcaaccttcc
A0A2R8M6L7_BCL2L11      --------------------------------atggcaaagcaaccttcc
A0A2R8M6L7_BCL2L11      --------------------------------atggcaaagcaaccttcc
A0A2R8M6L7_BCL2L11      --------------------------------atggcaaagcaaccttcc
A0A2R8M6L7_BCL2L11      --------------------------------atggcaaagcaaccttcc
U3F2S3_BAD-01           --------------------------------------atgttccagatc
F7HZL0_BMF-01           cggaggccgagaccctctcctggagtcacccaggggagatggagcc-atc
F7HZL0_BMF-02           --------------------------------------atggagcc-atc
F7HZL0_BMF-03           --------------------------------------atggagcc-atc
                                                                          

U3E722_HRK-01           --------------atgtgcccg--------------tgccccctgca--
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
U3F2S3_BAD-01           ccagagtttgagccgagtgagcaggaaga-------ctccagctctgcag
F7HZL0_BMF-01           tcagtgtgtg----gag-gagctggaggatgatgtgttccagccagagga
F7HZL0_BMF-02           tcagtgtgtg----gag-gagctggaggatgatgtgttccagccagagga
F7HZL0_BMF-03           tcagtgtgtg----gag-gagctggaggatgatgtgttccagccagagga
                                        * *  *               * *  *       

U3E722_HRK-01           ------------------------ccgcggccgcggcccc-----ccggc
A0A2R8M6L7_BCL2L11      gagacctccccagctcagac----ctggggcccctacctc-----cctac
A0A2R8M6L7_BCL2L11      gagacctccccagctcagac----ctggggcccctacctc-----cctac
A0A2R8M6L7_BCL2L11      gagacctccccagctcagac----ctggggcccctacctc-----cctac
A0A2R8M6L7_BCL2L11      gagacctccccagctcagac----ctggggcccctacctc-----cctac
A0A2R8M6L7_BCL2L11      gagacctccccagctcagac----ctggggcccctacctc-----cctac
A0A2R8M6L7_BCL2L11      gagacctccccagctcagac----ctggggcccctacctc-----cctac
A0A2R8M6L7_BCL2L11      gagacctccccagctcagac----ctggggcccctacctc-----cctac
A0A2R8M6L7_BCL2L11      gagacctccccagctcagac----ctggggcccctacctc-----cctac
U3F2S3_BAD-01           agaggggcctgagccccagcaccgcaggggacaggcccccaggctctggc
F7HZL0_BMF-01           tggggagccagggacccaac----ccgggagcttgctctctg---ctgac
F7HZL0_BMF-02           tggggagccagggacccaac----ccgggagcttgctctctg---ctgac
F7HZL0_BMF-03           tggggagccagggacccaac----ccgggagcttgctctctg---ctgac
                                                * * *  *     * *     *   *

U3E722_HRK-01           cgtttgcgcc----------------------------------------
A0A2R8M6L7_BCL2L11      agacagagccacaa------------------------------------
A0A2R8M6L7_BCL2L11      agacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggac
A0A2R8M6L7_BCL2L11      agacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggac
A0A2R8M6L7_BCL2L11      agacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggac
A0A2R8M6L7_BCL2L11      agacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggac
A0A2R8M6L7_BCL2L11      agacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggac
A0A2R8M6L7_BCL2L11      agacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggac
A0A2R8M6L7_BCL2L11      agacagagccaca-------------------------------------
U3F2S3_BAD-01           aagcatcgacgccaggccc------caggcctcccgggggacgccag---
F7HZL0_BMF-01           c--tatttgcccagagcctactggactgccccctcagtcggcttcagctc
F7HZL0_BMF-02           c--tatttgcccagagcctactggactgccccctcagtcggcttcagctc
F7HZL0_BMF-03           c--tatttgcccagagcctactggactgccccctcagtcggcttcagctc
                                 *                                        

U3E722_HRK-01           ------------tgcagcgcggg---tcgcctg-gggctgcgctcgtcc-
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      agctgcctccacggcagccctca---gggcccgctggccccaccggcca-
A0A2R8M6L7_BCL2L11      agctgcctccacggcagccctca---gggcccgctggccccaccggcca-
A0A2R8M6L7_BCL2L11      agctgcctccacggcagccctca---gggcccgctggccccaccggcca-
A0A2R8M6L7_BCL2L11      agctgcctccacggcagccctca---gggcccgctggccccaccggcca-
A0A2R8M6L7_BCL2L11      agctgcctccacggcagccctca---gggcccgctggccccaccggcca-
A0A2R8M6L7_BCL2L11      agctgcctccacggcagccctca---gggcccgctggccccaccggcca-
A0A2R8M6L7_BCL2L11      --------------------------------------------------
U3F2S3_BAD-01           -------tcaccagcag---------ggacagtcaaccagcagcagccac
F7HZL0_BMF-01           ttccctctcacccactgctgtggccctggccttcgacc--caccagcca-
F7HZL0_BMF-02           ttccctctcacccactgctgtggccctggccttcgacc--caccagcca-
F7HZL0_BMF-03           ttccctctcacccactgctgtggccctggccttcgacc--caccagcca-
                                                                          

U3E722_HRK-01           ------------------gccgcg-------------cagctcaccgccg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ------------------gccccggcccttttgctaccagatccccgctt
A0A2R8M6L7_BCL2L11      ------------------gccccggcccttttgctaccagatccccgctt
A0A2R8M6L7_BCL2L11      ------------------gccccggcccttttgctaccagatccccgctt
A0A2R8M6L7_BCL2L11      ------------------gccccggcccttttgctaccagatccccgctt
A0A2R8M6L7_BCL2L11      ------------------gccccggcccttttgctaccagatccccgctt
A0A2R8M6L7_BCL2L11      ------------------gccccggcccttttgctaccagatccccgctt
A0A2R8M6L7_BCL2L11      --------------------------------------------------
U3F2S3_BAD-01           catggaggcgctggggctgtggagacccg--------gagtc------gc
F7HZL0_BMF-01           -----ggaagacaaggctacccagaccct--------cagcccagcctcc
F7HZL0_BMF-02           -----ggaagacaaggctacccagaccct--------cagcccagcctcc
F7HZL0_BMF-03           -----ggaagacaaggctacccagaccct--------cagcccagcctcc
                                                                          

U3E722_HRK-01           cccggctc------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ttcatctttgtgagaagatcctccgtgctgtctcgatcctccagtgggta
A0A2R8M6L7_BCL2L11      ttcatctttgtgagaagatcctccgtgctgtctcgatcctccagtgggta
A0A2R8M6L7_BCL2L11      ttcatctttgtgagaagatcctccgtgctgtctcgatcctccagtgggta
A0A2R8M6L7_BCL2L11      ttcatctttgtgagaagatcctccgtgctgtctcgatcctccagtgggta
A0A2R8M6L7_BCL2L11      ttcatctttgtgagaagatcctccgtgctgtctcgatcctccagtgggta
A0A2R8M6L7_BCL2L11      ttcatctttgtgagaagatcctccgtgctgtctcgatcctccagtgggta
A0A2R8M6L7_BCL2L11      --------------------------------------------------
U3F2S3_BAD-01           cacagct-------------------------------------------
F7HZL0_BMF-01           cccagcc-------------------------------------------
F7HZL0_BMF-02           cccagcc-------------------------------------------
F7HZL0_BMF-03           cccagcc-------------------------------------------
                                                                          

U3E722_HRK-01           ------------------aaggcgctcggcg---acgagctgcaccagcg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgagttgtgacaaat
A0A2R8M6L7_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgagttgtgacaaat
A0A2R8M6L7_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgagttgtgacaaat
A0A2R8M6L7_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgagttgtgacaaat
A0A2R8M6L7_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgagttgtgacaaat
A0A2R8M6L7_BCL2L11      tttctcttttgacacagacaggagcccagcacccatgagttgtgacaaat
A0A2R8M6L7_BCL2L11      ---------------agacaggagcccagcacccatgagttgtgacaaat
U3F2S3_BAD-01           ------------------c--gtaccccgcagggacggaggaggacgaag
F7HZL0_BMF-01           ------------------aaggtgtcatgctgccttgtggggtgactgag
F7HZL0_BMF-02           ------------------aaggtgtcatgctgccttgtggggtgactgag
F7HZL0_BMF-03           ------------------aaggtgtcatgctgccttgtggggtgactgag
                                                                          

U3E722_HRK-01           cacc----atg----------------tggcggcgccgcgcgc-----gg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      caac----acaaaccccaagtcctccttgccaggccttcaacc-----ac
A0A2R8M6L7_BCL2L11      caac----acaaaccccaagtcctccttgccaggccttcaacc-----ac
A0A2R8M6L7_BCL2L11      caac----acaaaccccaagtcctccttgccaggccttcaacc-----ac
A0A2R8M6L7_BCL2L11      caac----acaaaccccaagtcctccttgccaggccttcaacc-----ac
A0A2R8M6L7_BCL2L11      caac----acaaaccccaagtcctccttgccaggccttcaacc-----ac
A0A2R8M6L7_BCL2L11      caac----acaaaccccaagtcctccttgccaggccttcaacc-----ac
A0A2R8M6L7_BCL2L11      caac----acaaaccccaagtcctccttgccaggccttcaacc-----ac
U3F2S3_BAD-01           ggatggaggaggagcccagc--ccctttcggggccgttcgcgct--cggc
F7HZL0_BMF-01           gaac----------cccagcgactcttttacggcaatgctggctaccggc
F7HZL0_BMF-02           gaac----------cccagcgactcttttacggcaatgctggctaccggc
F7HZL0_BMF-03           gaac----------cccagcgactcttttacggcaatgctggctaccggc
                                                                          

U3E722_HRK-01           agccggagggcgccggcgccc--ggcgcgctccccacctactggc-----
A0A2R8M6L7_BCL2L11      ---------------gcttccatgaggcaatctcag---gctgaa-----
A0A2R8M6L7_BCL2L11      tatctcagtgcaatggcttccatgaggcaatctcag---gctgaa-----
A0A2R8M6L7_BCL2L11      tatctcagtgcaatggcttccatgaggcaatctcag---gctgaa-----
A0A2R8M6L7_BCL2L11      tatctcagtgcaatggcttccatgaggcaatctcag---gctgaa-----
A0A2R8M6L7_BCL2L11      tatctcagtgcaatggcttccatgaggcaatctcag---gctgaa-----
A0A2R8M6L7_BCL2L11      tatctcagtgcaatggcttccatgaggcaatctcag---gctgaa-----
A0A2R8M6L7_BCL2L11      tatctcagtgcaatggcttccatgaggcaatctcag---gctgaa-----
A0A2R8M6L7_BCL2L11      tatctcagtgcaatggcttccatgaggcaatctcag---gctgaa-----
U3F2S3_BAD-01           acccc-------ccaacctct---gggcagcacagcgctat-ggccgcga
F7HZL0_BMF-01           ttcctctccctgccagtttcc---cggcagtcttgccccttggggagcag
F7HZL0_BMF-02           ttcctctccctgccagtttcc---cggcagtcttgccccttggggagcag
F7HZL0_BMF-03           ttcctctccctgccagtttcc---cggcagtcttgccccttggggagcag
                                           *      **              *       

U3E722_HRK-01           ---cctggctgtgcgcggc-----------------cg------------
A0A2R8M6L7_BCL2L11      ---cctgcaggtatgcgcc-----------------cggagatatggatc
A0A2R8M6L7_BCL2L11      ---cctgcaggtatgcgcc-----------------cggagatatggatc
A0A2R8M6L7_BCL2L11      ---cctgcaggtatgcgcc-----------------cggagatatggatc
A0A2R8M6L7_BCL2L11      ---cctgcaggtatgcgcc-----------------cggagatatggatc
A0A2R8M6L7_BCL2L11      ---cctgcaggtatgcgcc-----------------cggagatatggatc
A0A2R8M6L7_BCL2L11      ---cctgcaggtatgcgcc-----------------cggagatatggatc
A0A2R8M6L7_BCL2L11      ---cctgcaggtatgcgcc-----------------cggagatatggatc
A0A2R8M6L7_BCL2L11      ---cctgcaggtatgcgcc-----------------cggagatatggatc
U3F2S3_BAD-01           gctccggaggatgagtgatgagtttgtggactcctttaagggacttcctc
F7HZL0_BMF-01           ccccccgaagggcagtggcaacatcgag--------cagaggtacagatt
F7HZL0_BMF-02           ccccccgaagggcagtggcaacatcgag--------cagaggtacagatt
F7HZL0_BMF-03           ccccccgaagggcagtggcaacatcgag--------cagaggtacagatt
                           ** *       * *                                 

U3E722_HRK-01           ---cgcaggtggcggcgc-----tggcggcctggct--gctcggcaggcg
A0A2R8M6L7_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaac--gcttattatcca
A0A2R8M6L7_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaac--gcttattatcca
A0A2R8M6L7_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaac--gcttattatcca
A0A2R8M6L7_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaac--gcttattatcca
A0A2R8M6L7_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaac--gcttattatcca
A0A2R8M6L7_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaac--gcttattatcca
A0A2R8M6L7_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaac--gcttattatcca
A0A2R8M6L7_BCL2L11      gcccaagagttgcggcgtatcggagacgagtttaac--gcttattatcca
U3F2S3_BAD-01           gcccgaagagcgcgg-gcacagcaacgcag---------------atgcg
F7HZL0_BMF-01           gcccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgca
F7HZL0_BMF-02           gcccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgca
F7HZL0_BMF-03           gcccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgca
                           *        * * *                               * 

U3E722_HRK-01           gaacttgtag----------------------------------------
A0A2R8M6L7_BCL2L11      aggaggctgg----------------------------------------
A0A2R8M6L7_BCL2L11      aggagggtaat---gatactttctttaccccctttt--------------
A0A2R8M6L7_BCL2L11      aggaggata-----------------------------------------
A0A2R8M6L7_BCL2L11      aggagggta-------------------------------------tttt
A0A2R8M6L7_BCL2L11      aggagggtaaactggatactgcccttttgccatcggaaggaagtgtgtct
A0A2R8M6L7_BCL2L11      aggaggttaga---------------------------------------
A0A2R8M6L7_BCL2L11      aggagggtaaactggatactgcccttttgccatcggaaggaagtgtgtct
A0A2R8M6L7_BCL2L11      aggagggtaaactggatactgcccttttgccatcggaaggaagtgtgtct
U3F2S3_BAD-01           gcaa---------------agctccagctggacgcgagtcatccagtcct
F7HZL0_BMF-01           gcaacaccagcagaaccgaaatcgcatgtggtggcaggtcctcctcttcc
F7HZL0_BMF-02           gcaa----------------------------------------------
F7HZL0_BMF-03           gcaa---ctgaataaatggaggcctatagagattaggatgactttccttc
                                                                          

U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ---------------------------------------ctgcttacccc
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tgaataattaccaa----gcagctgaagaccacccacacatggttatctt
A0A2R8M6L7_BCL2L11      tgaagcattcccggttttaccatcgaaagccagccaga-gtgcttactgg
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tgaagcattcccggttttaccatcgaaagccagccaga-gtgcttactgg
A0A2R8M6L7_BCL2L11      tgaagcattcccggttttaccatcgaaagccagccaga-gtgcttactgg
U3F2S3_BAD-01           ggt-----------------------------------------------
F7HZL0_BMF-01           ------------------tgcacaacctggctttgaatggagaagagaac
F7HZL0_BMF-02           --------------------------------------------------
F7HZL0_BMF-03           agagacacaaccaagaaatgccaagttgggccttgaatcca-aagacaag
                                                                          

U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------caaaactcttggcatcctccacgtga----------------
A0A2R8M6L7_BCL2L11      tcc------------ccctccacactgtattttttttaaaaaaagacaaa
A0A2R8M6L7_BCL2L11      --------------------tctcttctacctg-----------------
A0A2R8M6L7_BCL2L11      acgactgtta-----cgttacattgtccgcctggtgtggagaa-------
A0A2R8M6L7_BCL2L11      accacaatcagagatcgtt-caatcaatacttgctgtgccaaagcccaaa
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      accacaatcagagatcgtt-caatcaatacttgctgtgccaaagcccaaa
A0A2R8M6L7_BCL2L11      accacaatcagagatcgtt-caatcaatacttgctgtgccaaagcccaaa
U3F2S3_BAD-01           ------------------------------------gggataggaacttg
F7HZL0_BMF-01           aggaatggggcaggccc-------------------gagcttccagccag
F7HZL0_BMF-02           ------------------------------------gaaactgaggcttg
F7HZL0_BMF-03           acgaaggagacaggattttgcatgggaggtgagagggagacaggggcttg
                                                                          

U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      gtg----gcttgtcataa--------------------------------
A0A2R8M6L7_BCL2L11      -------------attga--------------------------------
A0A2R8M6L7_BCL2L11      ----------tgcattga--------------------------------
A0A2R8M6L7_BCL2L11      gaattatttctgcgttaagcttcaggacgatgccacccttgatgcccact
A0A2R8M6L7_BCL2L11      -----------gaaatag--------------------------------
A0A2R8M6L7_BCL2L11      gaattatttctgaaatag--------------------------------
A0A2R8M6L7_BCL2L11      gaattatttctgaaatag--------------------------------
U3F2S3_BAD-01           ggcag-----------------------gggaggctccgctccttc----
F7HZL0_BMF-01           gccagaagggcatgctctggaacccagcagga-tcacggctgcctctgc-
F7HZL0_BMF-02           ----------------gagaattgaagtaacacgcccaagtcacacta--
F7HZL0_BMF-03           ggagggaggaaaagaagaggagtggagagggagtcccagctcattccgct
                                                                          

U3E722_HRK-01           --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tcacgatggcctgtacatctgaccgtgtgtgggagc------ctgcagca
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --aaaatgtccaagatatctaa----------------------------
A0A2R8M6L7_BCL2L11      --aaaatgtccaagatatctaa----------------------------
U3F2S3_BAD-01           ------------------------------------------ccagtg--
F7HZL0_BMF-01           -------------acgtcttcccttccctccctgctgcggtgctcatgga
F7HZL0_BMF-02           --------------------------------taat------ttgctg--
F7HZL0_BMF-03           ctgcctagagcaggcctcttttctgccttccctgac------ttcttgcc
                                                                          

U3E722_HRK-01           ----------
A0A2R8M6L7_BCL2L11      ----------
A0A2R8M6L7_BCL2L11      ----------
A0A2R8M6L7_BCL2L11      ----------
A0A2R8M6L7_BCL2L11      ----------
A0A2R8M6L7_BCL2L11      caggatttag
A0A2R8M6L7_BCL2L11      ----------
A0A2R8M6L7_BCL2L11      ----------
A0A2R8M6L7_BCL2L11      ----------
U3F2S3_BAD-01           ---------a
F7HZL0_BMF-01           gaggatctaa
F7HZL0_BMF-02           ---------a
F7HZL0_BMF-03           acctctttaa
                                  

© 1998-2022Legal notice