Dataset for CDS classical BH3-containing proteins of organism Calidris pygmaea

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C3JPH7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Calidris pygmaea GN=PMAIP1 (length=165 residues).
atgttacccggtaggaccgtacggaaagcgacgccccccgccgctccagcagagcgggaggtggtggcggagtgcgccct
gcagctgcgcaggatcggcgacaagtgggacctgcggcagaagattctgaacctcctgacaaagctgttctgcccggaga
cgtga
>gnl|bcl2dbcds|A0A8C3JX57_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Calidris pygmaea GN=BCL2L11 (length=192 residues).
tgcaaggaggtacagccagccatctccaaacctgaaatctggattgcacaggagctgcggcgcattggagacgagttcaa
tgcctcctattgtccaagaagggtaactttcatctttttactttccatttctttacacactgtctctaaaagggaaaagc
ttaatcatctctggaaactagttctgcggtaa
>gnl|bcl2dbcds|A0A8C3KIN9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Calidris pygmaea GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcgtacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacatgtccctccggttggctttgcattggatccgcacctccaagaggagcctcaggaaggtcagc
gggaagcacgtgccgaggtgcagatcgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacgcggaggcgaacag
gaaccacactgggcagaggtga
>gnl|bcl2dbcds|A0A8C3KIN9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Calidris pygmaea GN=BMF (length=591 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcgtacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacatgtccctccggttggctttgcattggatccgcacctccaagaggagcctcaggaaggtcagc
gggaagcacgtgccgaggtgcagatcgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
gtagggtgtctctggaggggatggtgggggtttagctctccaggagtggtgctctggaagaccagatccaggcatcagct
aagcaggccgctgtctaaggcagcagactaa
© 1998-2022Legal notice