Dataset for CDS classical BH3-containing proteins of organism Calidris pygmaea

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3JX57_BCL2L11      ---------------tgcaaggagg-------------------------
A0A8C3JPH7_PMAIP1-      at-----------gttacccggtag-------------------------
A0A8C3KIN9_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C3KIN9_BMF-02       atggatcgccccagctacctggaagaggactattctagcctggatgggct
                                       * *  **  *                         

A0A8C3JX57_BCL2L11      --------------------------------------------------
A0A8C3JPH7_PMAIP1-      --------------------------------------------------
A0A8C3KIN9_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C3KIN9_BMF-02       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                                                                          

A0A8C3JX57_BCL2L11      -----------------------------------------tacagc---
A0A8C3JPH7_PMAIP1-      ------------------------------------gaccgtacgg----
A0A8C3KIN9_BMF-01       gtgagatgactgcaactggcattttcacacagaaccagtcgtacagctgc
A0A8C3KIN9_BMF-02       gtgagatgactgcaactggcattttcacacagaaccagtcgtacagctgc
                                                                 *** *    

A0A8C3JX57_BCL2L11      --------------------------------------------------
A0A8C3JPH7_PMAIP1-      --------------------------------------------------
A0A8C3KIN9_BMF-01       cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
A0A8C3KIN9_BMF-02       cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
                                                                          

A0A8C3JX57_BCL2L11      -----------------------------cagc-----------------
A0A8C3JPH7_PMAIP1-      -------------------------aaagcgac-----------------
A0A8C3KIN9_BMF-01       tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A8C3KIN9_BMF-02       tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
                                                     *  *                 

A0A8C3JX57_BCL2L11      --------------------------------------------------
A0A8C3JPH7_PMAIP1-      ----------------------------------------------gccc
A0A8C3KIN9_BMF-01       cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C3KIN9_BMF-02       cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
                                                                          

A0A8C3JX57_BCL2L11      --------------------------------------------------
A0A8C3JPH7_PMAIP1-      c-------------------------------------------------
A0A8C3KIN9_BMF-01       cggagactcttctatgggaatgctggttaccgtttacatgtccctccggt
A0A8C3KIN9_BMF-02       cggagactcttctatgggaatgctggttaccgtttacatgtccctccggt
                                                                          

A0A8C3JX57_BCL2L11      -------------------catctccaaac--------------------
A0A8C3JPH7_PMAIP1-      ----------------ccgccgctccagcag----------------agc
A0A8C3KIN9_BMF-01       tggctttgcattggatccgcacctccaagaggagcctcaggaaggtcagc
A0A8C3KIN9_BMF-02       tggctttgcattggatccgcacctccaagaggagcctcaggaaggtcagc
                                           *  *****                       

A0A8C3JX57_BCL2L11      ------------ctgaaatctggattgcacaggagctgcggcgcattgga
A0A8C3JPH7_PMAIP1-      gggaggtg-gtggcggagtg-----cgccctgcagctgcgcaggatcggc
A0A8C3KIN9_BMF-01       gggaagcacgtgccgaggtgcagatcgcacggaagttgcagtgcattgcc
A0A8C3KIN9_BMF-02       gggaagcacgtgccgaggtgcagatcgcacggaagttgcagtgcattgcc
                                      *   *       ** * * ** ***   * ** *  

A0A8C3JX57_BCL2L11      gacgagttcaatgcctcctattgtccaa----------------------
A0A8C3JPH7_PMAIP1-      gacaagtggga-----cctgc-----------------------------
A0A8C3KIN9_BMF-01       gaccagttcca-----ccggctccacatacagaggcatcagcagaacaga
A0A8C3KIN9_BMF-02       gaccagttcca-----ccggctccacatacagagg-----gtagggtgtc
                        *** ***   *     **                                

A0A8C3JX57_BCL2L11      ----------gaagggtaactttcatctttttactttccatttctttaca
A0A8C3JPH7_PMAIP1-      ----------ggcagaagattctgaacctcctgacaaagctgttctgc--
A0A8C3KIN9_BMF-01       aatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaa
A0A8C3KIN9_BMF-02       tctggag-gggatggtgggggtttagctctccaggagtggtgctctggaa
                                  *   *       *   *             *    *    

A0A8C3JX57_BCL2L11      cactgtctctaaaagggaaaagcttaatcatctctggaaactagttctgc
A0A8C3JPH7_PMAIP1-      ------------ccggagacg-----------------------------
A0A8C3KIN9_BMF-01       cgcggaggcgaacaggaacca-----------cactg-----ggcagagg
A0A8C3KIN9_BMF-02       gaccagatc---caggcatcagctaagcaggccgctgtctaaggcagcag
                                      **                                  

A0A8C3JX57_BCL2L11      ggtaa
A0A8C3JPH7_PMAIP1-      --tga
A0A8C3KIN9_BMF-01       --tga
A0A8C3KIN9_BMF-02       actaa
                          * *

© 1998-2022Legal notice