Dataset for CDS classical BH3-containing proteins of organism Caenorhabditis remanei

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|E3LTJ5_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis remanei GN=egl-1 (length=345 residues).
atgctcacattcgcctcatcctcctcatcggaccttttcctctcgatgcccaattcccacttcgacattgtcaaaccctt
ctgctgtatcaacgaaaaaaagattatgtgctccgactactgtaacacgtcttctgatgacgcctctacatcttctgagt
tcgctgatgattctggatttttcgatgactccgaaaccgacgactacatcaccaaaaccgcgtatgaaatcggcacaaaa
ctcgttgcgatgtgtgatgacttcgatgcccaaatgatgtcatactccagaacagtaccctccagaagtattctcagtcg
tgttttcgacttcttcgccttctag
>gnl|bcl2dbcds|E3M1A5_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis remanei GN=egl-1 (length=333 residues).
atgcttacattcgcctcctcttcggaccttcttatttcgatgccttcatcacactatgacttcgtcaaacccttctattc
caacaagaacatgctgttctccgatttccccacgtcttctgatcatgccgtcacgtcttctgaattcgctgacgattctg
aattttttgattcctccgaaaccagccattacattcacgagattagccaggaaatcggcaccaaattggctgcaatgtgc
gatgacttcgatgccaaaatgatgtcatactccagaagtggatccacttccagaagtcttctcggacgcttcctcgactt
cttcgccttctga
>gnl|bcl2dbcds|E3MP30_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis remanei GN=egl-1 (length=300 residues).
atgctttcattactctgtgacttcgtcaaacccttctactccaacaacttcaagaacatgatgtttttcgacttccacac
gtcttctcttcatgccgtgacgtcttctgagttcgctgaagattctggatttttagattcctccaaaaccagtcactaca
ttcacgagagaagtaaggaaatcggcaccaagttgactacaatgtgcgatggcttcgatgccaaaatgatgtcatactca
agaagtgaatctacctccagaagtcttctcgggcgtttttacgacttctttgccttctga
© 1998-2022Legal notice