Dataset for CDS BCL2L11 of organism Bos mutus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|L8IVA4_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Bos mutus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccgggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccacagggcccgctggccccaccggccagccctggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatat
tacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacat
cgtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|L8IVA4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos mutus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccgggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtc
tggtgtggaggatgcagtga
© 1998-2020Legal notice