Dataset for CDS BCL2L11 of organism Bos mutus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


L8IVA4_BCL2L11-02      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
L8IVA4_BCL2L11-01      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
                       **************************************************

L8IVA4_BCL2L11-02      acaattgcagcctgccgagaggcctcctcagctcagaccgggggccccca
L8IVA4_BCL2L11-01      acaattgcagcctgccgagaggcctcctcagctcagaccgggggccccca
                       **************************************************

L8IVA4_BCL2L11-02      cctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgc
L8IVA4_BCL2L11-01      cctctttacagacagagcggca----------------------------
                       **********************                            

L8IVA4_BCL2L11-02      tgcccccaaggcagcccacagggcccgctggccccaccggccagccctgg
L8IVA4_BCL2L11-01      --------------------------------------------------
                                                                         

L8IVA4_BCL2L11-02      ccctttcgctaccagatccccgctcttcatcttcgtgagaagatcctcct
L8IVA4_BCL2L11-01      --------------------------------------------------
                                                                         

L8IVA4_BCL2L11-02      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
L8IVA4_BCL2L11-01      ----------------------------------------agacaggagc
                                                               **********

L8IVA4_BCL2L11-02      ccggcacccatgagttgtgacaaatccacacagaccccaagccctccttg
L8IVA4_BCL2L11-01      ccggcacccatgagttgtgacaaatccacacagaccccaagccctccttg
                       **************************************************

L8IVA4_BCL2L11-02      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
L8IVA4_BCL2L11-01      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
                       **************************************************

L8IVA4_BCL2L11-02      aggctgtacctgcagatacacgcccagagatatggattgcccaagagcta
L8IVA4_BCL2L11-01      aggctgtacctgcagatacacgcccagagatatggattgcccaagagcta
                       **************************************************

L8IVA4_BCL2L11-02      cggcgtatcggagacgagtttaatgcatattacccaagaagggtcttcgt
L8IVA4_BCL2L11-01      cggcgtatcggagacgagtttaatgcatattacccaagaagggtcttcgt
                       **************************************************

L8IVA4_BCL2L11-02      gcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtct
L8IVA4_BCL2L11-01      gcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtct
                       **************************************************

L8IVA4_BCL2L11-02      tgcgctacatcgtgcgtctggtgtggaggatgcagtga
L8IVA4_BCL2L11-01      tgcgctacatcgtgcgtctggtgtggaggatgcagtga
                       **************************************

© 1998-2020Legal notice