Dataset for CDS classical BH3-containing proteins of organism Bos mutus grunniens

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8B9XKZ1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Bos mutus grunniens GN=BBC3 (length=396 residues).
gtgagagccactgcagaggctgcccgggcatgtccgtgccagctgcccggggctttcttctccccctgggtcccccacca
gattcgtggtcctcagccttcactctcgcccgcggagcagcacctggaatcaccagtgcccagcgccccgggggccctgg
cgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgaggagcccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A8B9XKZ1_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Bos mutus grunniens GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcacc
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgaggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A8B9XQ92_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Bos mutus grunniens GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaagagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgaatgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A8B9YZT6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccgggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatgggtaagcaataccggggaggcgactgt
gcatgcgtgggtgcttaa
>gnl|bcl2dbcds|A0A8C0AME3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos mutus grunniens GN=BAD (length=348 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggacaggccccaggtctcagcaagcactggctaacagccccaggcctcctggggaagctggtcaccagcaggggcagcc
ggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccccgcagggccagagg
ataatgaagagacggaggaggaggatctcggcctttaggggccgctcgcgttcggcgcccccaacctctgggctgcacag
cgatatggccgcgagctccggaggatga
© 1998-2022Legal notice