Dataset for CDS classical BH3-containing proteins of organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9YZT6_BCL2L11      atg--------------gcaaagcaaccttccgatgtaagttctgagtgt
A0A8B9XQ92_PMAIP1-      atg--------------------------cctgga---------------
A0A8C0AME3_BAD-01       atgttccaga------------------tcccagagtttgagcagagt--
A0A8B9XKZ1_BBC3-01      gtg-----------------------------agagccactgcagaggct
A0A8B9XKZ1_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcct
                         **                                               

A0A8B9YZT6_BCL2L11      gacagagaaggtggacaattgcagc-----------ctgccg--agaggc
A0A8B9XQ92_PMAIP1-      -----aggagg------gctcg---------------------taagagc
A0A8C0AME3_BAD-01       -gagcaggaag------actccagcc----------ctgcagataggggc
A0A8B9XKZ1_BBC3-01      -gcccgggcat------gtccgtgc-----------cagctgcccggggc
A0A8B9XKZ1_BBC3-02      ggcccgcgacg------gcccgcgccccttcccgctcagccgcctggtgc
                                                                        **

A0A8B9YZT6_BCL2L11      c-------------------------------------------------
A0A8B9XQ92_PMAIP1-      g-------------------------------------------------
A0A8C0AME3_BAD-01       c-------------------------------------------------
A0A8B9XKZ1_BBC3-01      ttt------------------------------------cttctccccct
A0A8B9XKZ1_BBC3-02      cctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgccccc
                                                                          

A0A8B9YZT6_BCL2L11      --------------------------------------------------
A0A8B9XQ92_PMAIP1-      --------------------------------------------------
A0A8C0AME3_BAD-01       --------------------------------------------------
A0A8B9XKZ1_BBC3-01      --------------------------------------------------
A0A8B9XKZ1_BBC3-02      gccgcccccgccctgctgcccgccgcctacctctgcgcccccaccgcccc
                                                                          

A0A8B9YZT6_BCL2L11      --------------------------------------------------
A0A8B9XQ92_PMAIP1-      --------------------------------------------------
A0A8C0AME3_BAD-01       --------------------------------------------------
A0A8B9XKZ1_BBC3-01      -----------------------gggtcccccaccagattcg--------
A0A8B9XKZ1_BBC3-02      gcccgccgtcaccgccgccctgggggccccccgctggcctgggggtcccc
                                                                          

A0A8B9YZT6_BCL2L11      -------------------------------tcctcagc-----------
A0A8B9XQ92_PMAIP1-      ---------------------------------cccagc-----------
A0A8C0AME3_BAD-01       ----------------------------tgggccccagc-----------
A0A8B9XKZ1_BBC3-01      ----------------------------tggtcctcagccttcactctcg
A0A8B9XKZ1_BBC3-02      gcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcg
                                                         * ****           

A0A8B9YZT6_BCL2L11      -------------------------------tcaga---ccgggggcccc
A0A8B9XQ92_PMAIP1-      -------------------------------cgagccccacgcgggtccc
A0A8C0AME3_BAD-01       cccacaggacag---------gccccaggtctcagc-------aagcact
A0A8B9XKZ1_BBC3-01      cccgcggagcagcacctggaatcaccagtgcccagcgccccgggggccct
A0A8B9XKZ1_BBC3-02      cccgcggagcagcacctggaatcaccagtgcccagcgccccgggggccct
                                                         **          *  * 

A0A8B9YZT6_BCL2L11      cacc----------------------------tctttacagacagagcgg
A0A8B9XQ92_PMAIP1-      ggcaga--------------------------tcctgaagttgaatg---
A0A8C0AME3_BAD-01       ggctaacagcccca-------ggcc-------tcctggggaagctggtca
A0A8B9XKZ1_BBC3-01      ggcgggcggccccacccaagcggccccgggagtccggggggaggagg---
A0A8B9XKZ1_BBC3-02      ggcgggcggccccacccaagcggccccgggagtccggggggaggagg---
                          *                             **            *   

A0A8B9YZT6_BCL2L11      caagacaggagcc--------cggcacccatgagttgtgacaaatc-cac
A0A8B9XQ92_PMAIP1-      ---------------------tgccattc---agttgaggagaattggag
A0A8C0AME3_BAD-01       ccagcagggg------------------c---agc--cggccggcagcag
A0A8B9XKZ1_BBC3-01      --agcagtgggcccgagagatcggggccc---agctgcggcggatggcgg
A0A8B9XKZ1_BBC3-02      --agcagtgggcccgagagatcggggccc---agctgcggcggatggcgg
                                                    *   **    *           

A0A8B9YZT6_BCL2L11      acagaccccaagccctc------------------------------ctt
A0A8B9XQ92_PMAIP1-      acaaactgaattt-------------------------------------
A0A8C0AME3_BAD-01       ccaccatggaggcactg---gggctgtggagacc-------cggagtcgt
A0A8B9XKZ1_BBC3-01      acgacctcaacgcgctatacgagcggcggagacaagaggagcggcagcga
A0A8B9XKZ1_BBC3-02      acgacctcaacgcgctatacgagcggcggagacaagaggagcggcagcga
                         *       *                                        

A0A8B9YZT6_BCL2L11      gccaggccttcaaccattatctcagtgcaatgggtaagcaataccgggga
A0A8B9XQ92_PMAIP1-      ---------------------ccggcagaaacttgtgaatctgatatcca
A0A8C0AME3_BAD-01       cacagctcctaccccgcagggccagaggataatgaagagacggaggagga
A0A8B9XKZ1_BBC3-01      caccgcccctcacc-------ctggagggtcctgtacaatctcatcatgg
A0A8B9XKZ1_BBC3-02      caccgcccctcacc-------ctggagggtcctgtacaatctcatcatgg
                                                *                         

A0A8B9YZT6_BCL2L11      ggcgactgtgcat-------------------------------------
A0A8B9XQ92_PMAIP1-      aactcct---------------------------------cc--------
A0A8C0AME3_BAD-01       ggatctcggccttt---aggggccgctcgcgttcggcgcccccaacctct
A0A8B9XKZ1_BBC3-01      gactcctgccctttcccgggggccg--------aggagcccc--------
A0A8B9XKZ1_BBC3-02      gactcctgccctttcccgggggccg--------aggagcccc--------
                                                                          

A0A8B9YZT6_BCL2L11      -------------------------gcgtgggtgcttaa
A0A8B9XQ92_PMAIP1-      -------------------------gctcaggaacttga
A0A8C0AME3_BAD-01       gggctgcacagcgatatggccgcgagctccggaggatga
A0A8B9XKZ1_BBC3-01      -----------cgaggtg-----gagcccaattag----
A0A8B9XKZ1_BBC3-02      -----------cgaggtg-----gagcccaattag----
                                                 **            

© 1998-2022Legal notice