Dataset for CDS BMF of organism Astyanax mexicanus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3B1K1X5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Astyanax mexicanus GN=BMF (length=468 residues).
atggacgatgaggaggatgatgtgttcgttacggatccagagccttggcgttccccgatcagtgtgataaagcaggagga
gcgtggcacacagactccagggcggccgccggctcggaccaatggcatgctgccctgcggaatatccgaggagccaagac
gcctcttctacggtagtgcaggactgttattactggcaccgtctgcccgttctgaacgcgtcggggacgccatgtttcgg
gaggagcatcgagccgttgagcctcggcggcggccggcgcacagcgtggaggcccgtatcggacagaagctccagatgat
cggagaccagttttatcaagagcacatgctgcaacacagaaaccaaaggaaccagcagccgctttggttgcgcttggcgt
cggcgctctacacgctcctgttcgagagggagccggcggctcacgggaggcgagaggaccggaggtga
>gnl|bcl2dbcds|A0A8B9LSW6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Astyanax mexicanus GN=BMF (length=474 residues).
atggacgatgaggaggatgatgtgttcgttacggatccagagccttggcgttccccgatcagtgtgataaagcaggagga
gcgtggcacacagactccagggcggccgccggctcggaccaatggcatgctgccctgcggaatatccgaggagccaagac
gcctcttctacggtagtgcaggactgttattactggcaccgtctgcccgttctgaacgcgtcggggacgccatgtttcgg
gaggagcatcgagccgttgagcctcggcggcggccggcgcacagcgtggaggcccgtatcggacagaagctccagatgat
cggagaccagttttatcaagagcacatgctggatggaagcaatgttgtccactgttgcaaagagcttggcattgagagga
gctgcagtgcgagacattttccacgtcctgcatttgttttggccagacatttccttcagcaaagtctgatgtga
>gnl|bcl2dbcds|A0A8B9LSW6_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Astyanax mexicanus GN=BMF (length=468 residues).
atggacgatgaggaggatgatgtgttcgttacggatccagagccttggcgttccccgatcagtgtgataaagcaggagga
gcgtggcacacagactccagggcggccgccggctcggaccaatggcatgctgccctgcggaatatccgaggagccaagac
gcctcttctacggtagtgcaggactgttattactggcaccgtctgcccgttctgaacgcgtcggggacgccatgtttcgg
gaggagcatcgagccgttgagcctcggcggcggccggcgcacagcgtggaggcccgtatcggacagaagctccagatgat
cggagaccagttttatcaagagcacatgctgcaacacagaaaccaaaggaaccagcagccgctttggttgcgcttggcgt
cggcgctctacacgctcctgttcgagagggagccggcggctcacgggaggcgagaggaccggaggtga
© 1998-2022Legal notice