Dataset for CDS BMF of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1K1X5_BMF-01      atggacgatgaggaggatgatgtgttcgttacggatccagagccttggcg
A0A8B9LSW6_BMF-02      atggacgatgaggaggatgatgtgttcgttacggatccagagccttggcg
A0A8B9LSW6_BMF-01      atggacgatgaggaggatgatgtgttcgttacggatccagagccttggcg
                       **************************************************

A0A3B1K1X5_BMF-01      ttccccgatcagtgtgataaagcaggaggagcgtggcacacagactccag
A0A8B9LSW6_BMF-02      ttccccgatcagtgtgataaagcaggaggagcgtggcacacagactccag
A0A8B9LSW6_BMF-01      ttccccgatcagtgtgataaagcaggaggagcgtggcacacagactccag
                       **************************************************

A0A3B1K1X5_BMF-01      ggcggccgccggctcggaccaatggcatgctgccctgcggaatatccgag
A0A8B9LSW6_BMF-02      ggcggccgccggctcggaccaatggcatgctgccctgcggaatatccgag
A0A8B9LSW6_BMF-01      ggcggccgccggctcggaccaatggcatgctgccctgcggaatatccgag
                       **************************************************

A0A3B1K1X5_BMF-01      gagccaagacgcctcttctacggtagtgcaggactgttattactggcacc
A0A8B9LSW6_BMF-02      gagccaagacgcctcttctacggtagtgcaggactgttattactggcacc
A0A8B9LSW6_BMF-01      gagccaagacgcctcttctacggtagtgcaggactgttattactggcacc
                       **************************************************

A0A3B1K1X5_BMF-01      gtctgcccgttctgaacgcgtcggggacgccatgtttcgggaggagcatc
A0A8B9LSW6_BMF-02      gtctgcccgttctgaacgcgtcggggacgccatgtttcgggaggagcatc
A0A8B9LSW6_BMF-01      gtctgcccgttctgaacgcgtcggggacgccatgtttcgggaggagcatc
                       **************************************************

A0A3B1K1X5_BMF-01      gagccgttgagcctcggcggcggccggcgcacagcgtggaggcccgtatc
A0A8B9LSW6_BMF-02      gagccgttgagcctcggcggcggccggcgcacagcgtggaggcccgtatc
A0A8B9LSW6_BMF-01      gagccgttgagcctcggcggcggccggcgcacagcgtggaggcccgtatc
                       **************************************************

A0A3B1K1X5_BMF-01      ggacagaagctccagatgatcggagaccagttttatcaagagcacatgct
A0A8B9LSW6_BMF-02      ggacagaagctccagatgatcggagaccagttttatcaagagcacatgct
A0A8B9LSW6_BMF-01      ggacagaagctccagatgatcggagaccagttttatcaagagcacatgct
                       **************************************************

A0A3B1K1X5_BMF-01      gcaacacagaaaccaaaggaaccagcagccgctttggttgc-----gctt
A0A8B9LSW6_BMF-02      gcaacacagaaaccaaaggaaccagcagccgctttggttgc-----gctt
A0A8B9LSW6_BMF-01      g-------------gatggaagcaatgttgtccactgttgcaaagagctt
                       *              * **** **       *    *****     ****

A0A3B1K1X5_BMF-01      ggcgtc-------------------ggcgctctacacgctcctgttcgag
A0A8B9LSW6_BMF-02      ggcgtc-------------------ggcgctctacacgctcctgttcgag
A0A8B9LSW6_BMF-01      ggcattgagaggagctgcagtgcgagacattttccacg-tcctgcatttg
                       *** *                    * *  * * **** *****     *

A0A3B1K1X5_BMF-01      agggagccggcggctcacgggaggcgagaggaccggaggtga
A0A8B9LSW6_BMF-02      agggagccggcggctcacgggaggcgagaggaccggaggtga
A0A8B9LSW6_BMF-01      ttttggccagacatttccttcagcaaag----tctgatgtga
                            *** *    *  *   **   **     * ** ****

© 1998-2022Legal notice