Dataset for CDS BCL2L11 of organism Aquila chrysaetos chrysaetos

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A663E970_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BCL2L11 (length=327 residues).
atggctaagcaaccccccgaggtgaaagcgcaacgcgacggcgaaggcgggcggctaccgccggcggaggggccgggccc
ggccgcgcagctgcgccccggagctcccgccgctctgcccggctcccgcagccccgcgcccctcagctgcgacaaggcca
cgcagacccccagcccgccctgccaggccctcagccactgcctcagcgccatgggtgactcctcactcggttttttgctc
ttgtttcttcacaagccacgtggtgtcataggcgctagggtcgtacaactcccgcttgttttggtgagacccaaaattgg
tgcttga
>gnl|bcl2dbcds|A0A663E983_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BCL2L11 (length=201 residues).
atcacacaggctgctcccttctcccctgaagacgtacagcccgaaatctggattgcacaggagctgcggcgcattggaga
tgagttcaatgcctcctattgtccaagaagggtaactttcatcttttcactttccatttctttgcgcactgtctctaaaa
gggaaaagcttaatcatctctggaaactagttctgtggtga
© 1998-2020Legal notice