Dataset for CDS BCL2L11 of organism Aquila chrysaetos chrysaetos

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A663E970_BCL2L11      atggctaagcaaccccccgaggtgaaagcgcaacgcgacggcgaaggcgg
A0A663E983_BCL2L11      atcac-----------------------------------------acag
                        **  *                                          * *

A0A663E970_BCL2L11      gcggctaccgccggcggaggggccgggcccggccgcgcagctgcgccccg
A0A663E983_BCL2L11      gctgctcc--------------------------------cttctcccct
                        ** *** *                                ** * **** 

A0A663E970_BCL2L11      gagctcccgccgctctgcccggctcccgcagccccgcgcccctcagctgc
A0A663E983_BCL2L11      gaa-----gacgtacagcccgaaatctgga-----ttgcacaggagctgc
                        **      * **  * *****    * * *       ** *   ******

A0A663E970_BCL2L11      gacaaggccacgcagacccccagcccgccctgccaggccctcagccactg
A0A663E983_BCL2L11      ggcgcattggagatgagttcaatgcctc----------------ctattg
                        * *        *  **   * *  ** *                * * **

A0A663E970_BCL2L11      cctcagcgccatgggtgactcctcactcggttttttgctct-tgtttctt
A0A663E983_BCL2L11      tccaag----aagggtaact-----ttcatcttttcactttccatttctt
                         *  **    * **** ***      **   ****  ** *   ******

A0A663E970_BCL2L11      cacaagccacgtggtgtcataggcgctagggtcgtacaactcccgcttgt
A0A663E983_BCL2L11      tgcg-------------cactgtctctaaaagggaaaagcttaatcatct
                          *              **  * * ***     * * * **    * * *

A0A663E970_BCL2L11      tttggtgagacccaaaattggtgct----tga
A0A663E983_BCL2L11      ctgg----------aaactagttctgtggtga
                         * *          *** * ** **    ***

© 1998-2021Legal notice