Dataset for CDS classical BH3-containing proteins of organism Apteryx owenii

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8B9NX34_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Apteryx owenii GN=BMF (length=672 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtagcaggcatcccgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacacgctcctccagttggctttgcattggatccacatctccaagaggagcctcaggaaggccagc
gtgaagcacatgtggaggtgcagattgcacggaagttgcagtgcattgcagaccagtttcaccggctccacgtacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatggggaggcgaacag
gaaccacactgggcagaggcaaaattgtttctgtaagagcattcttcaaaaccctgcttggagttactggtggctattca
gtgtctgcaattgtttgcttccagttcagtga
>gnl|bcl2dbcds|A0A8B9NX34_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Apteryx owenii GN=BMF (length=537 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtagcaggcatcccgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacacgctcctccagttggctttgcattggatccacatctccaagaggagcctcaggaaggccagc
gtgaagcacatgtggaggtgcagattgcacggaagttgcagtgcattgcagaccagtttcaccggctccacgtacagagg
ctacccttgccaaaggcaaaggaaactttgaggactgcaccacagcagaaagaataa
>gnl|bcl2dbcds|A0A8B9QMZ1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Apteryx owenii GN=BCL2L11 (length=654 residues).
atggggccggcccgggggaggcggccgcggccgccccgctcgccccccccagcccccccgccgcccctctctctctcccc
ccgcaggcgacccggagccccgatggccaagcaagccgccgatgtaaactcgccgtgcgagcgcgaaggcgggcggctgc
aggcgccccggaggcccggccacccccggccgggggccccgacgtcgctgccctggggcgagggggacccggcgtcgccg
tcgccgcccgtggcgccccccaccagccccagccccttcgccacccgctcgccgctcttcatcttcgtgaggcgctcctc
gctgctgtcgcgctcctccagcgggtatttctcgttcgacgcggaccggagccccgcgcccatgagttgcgacaaggcca
cgcagaccccgagccccccttgccaagcctttaatcactacctgagtgcaatggcttccaggtggcggtctcactcgcta
gcagaagatatacagccagaaatatggattgcacaggaactgcggcgcattggcgatgaattcaatgcctcctattgtcc
gagaagggtaattttcagatttttcttctccatctctttctgtgcagtctctaaaagggaaaagcgtaatcatatctgga
agcgagttctgtag
>gnl|bcl2dbcds|A0A8B9S6H8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Apteryx owenii GN=PMAIP1 (length=156 residues).
gctccctccagaagggctcggattttccacctccccgccccaggaaaacgctcagtggccgagtgcgccatgcagctgcg
ccgcatcggggacaagtggaacctgcgccagaagatcctcaacctcctcgcaaagctgttctgcccggagacgtga
© 1998-2022Legal notice