Dataset for CDS classical BH3-containing proteins of organism Apteryx owenii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9NX34_BMF-01       atg--------------------------------------gatcgcccc
A0A8B9NX34_BMF-02       atg--------------------------------------gatcgcccc
A0A8B9QMZ1_BCL2L11      atggggccggcccgggggaggcggccgcggccgccccgctcgcccccccc
A0A8B9S6H8_PMAIP1-      -----------------------------------------gctccctcc
                                                                 *  * * **

A0A8B9NX34_BMF-01       agctacct------------------------------------------
A0A8B9NX34_BMF-02       agctacct------------------------------------------
A0A8B9QMZ1_BCL2L11      agcccccccgccgcccctctctctctccccccgcaggcgacccggagccc
A0A8B9S6H8_PMAIP1-      ag------------------------------------------------
                        **                                                

A0A8B9NX34_BMF-01       -----------------------------------------------gga
A0A8B9NX34_BMF-02       -----------------------------------------------gga
A0A8B9QMZ1_BCL2L11      cgatggccaagcaagccgccgatgtaaactcgccgtgcgagcgcgaaggc
A0A8B9S6H8_PMAIP1-      --------------------------------------------------
                                                                          

A0A8B9NX34_BMF-01       agaggactattctagcctggatgggctggacgat-------gacgtgttt
A0A8B9NX34_BMF-02       agaggactattctagcctggatgggctggacgat-------gacgtgttt
A0A8B9QMZ1_BCL2L11      gggcggctgcaggcgccccggaggcccggccacccccggccgggggcccc
A0A8B9S6H8_PMAIP1-      -----------------------------------------aagggctcg
                                                                    *     

A0A8B9NX34_BMF-01       cactctgatgactttggacttgcaggtcagcctggtgagatgactgcaac
A0A8B9NX34_BMF-02       cactctgatgactttggacttgcaggtcagcctggtgagatgactgcaac
A0A8B9QMZ1_BCL2L11      gacgtcgctgccctggggcgagggggacccggcgtcgccgtcgccgcccg
A0A8B9S6H8_PMAIP1-      ga------------------------------------------------
                         *                                                

A0A8B9NX34_BMF-01       tggcattttcacacagaaccagtcctacagctgccttctggggaggtttc
A0A8B9NX34_BMF-02       tggcattttcacacagaaccagtcctacagctgccttctggggaggtttc
A0A8B9QMZ1_BCL2L11      tggcgccccccaccagccccagccccttcgccacccgctcg---------
A0A8B9S6H8_PMAIP1-      --------------------------ttttccacctccccg---------
                                                      *  **  *  *         

A0A8B9NX34_BMF-01       aactattccccctcacacactgctgtggtcccggtagcaggcatcccgag
A0A8B9NX34_BMF-02       aactattccccctcacacactgctgtggtcccggtagcaggcatcccgag
A0A8B9QMZ1_BCL2L11      -------ccgctcttcatcttcgtgaggcgctcctcgctgctgtcgcg--
A0A8B9S6H8_PMAIP1-      -------cc-----------------------------------------
                               **                                         

A0A8B9NX34_BMF-01       cagcaggacaaggcaactcaaacactcagcccgtcctcttccagtcagga
A0A8B9NX34_BMF-02       cagcaggacaaggcaactcaaacactcagcccgtcctcttccagtcagga
A0A8B9QMZ1_BCL2L11      ----------------ctcctccagcgggtatttctcgttcgacgcggac
A0A8B9S6H8_PMAIP1-      --------------------------------------------------
                                                                          

A0A8B9NX34_BMF-01       tgttatgttgccttgtggagtcactgaagagccccggagactc-------
A0A8B9NX34_BMF-02       tgttatgttgccttgtggagtcactgaagagccccggagactc-------
A0A8B9QMZ1_BCL2L11      cggagccccgcgcccatgagttgcgacaaggccacgcagaccccgagccc
A0A8B9S6H8_PMAIP1-      -------------------------------ccaggaaaacgc-------
                                                       **  * * ** *       

A0A8B9NX34_BMF-01       -ttctatgggaatgctggttaccgtttacacgc----tcctccagttggc
A0A8B9NX34_BMF-02       -ttctatgggaatgctggttaccgtttacacgc----tcctccagttggc
A0A8B9QMZ1_BCL2L11      cccttgccaagcctttaatcactacctgagtgcaatggcttccaggtggc
A0A8B9S6H8_PMAIP1-      ------------------tcagtggccgagtgc-----------------
                                          * *          **                 

A0A8B9NX34_BMF-01       tttgcattggatccacatctccaagaggagcctcaggaaggccagcgtga
A0A8B9NX34_BMF-02       tttgcattggatccacatctccaagaggagcctcaggaaggccagcgtga
A0A8B9QMZ1_BCL2L11      ---------ggtctcactcgctagcagaagat------------------
A0A8B9S6H8_PMAIP1-      -----------------------------gcc------------------
                                                     *                    

A0A8B9NX34_BMF-01       agcacatgtggaggtgcagattgcacggaagttgcagtgcattgcagacc
A0A8B9NX34_BMF-02       agcacatgtggaggtgcagattgcacggaagttgcagtgcattgcagacc
A0A8B9QMZ1_BCL2L11      -atacagccagaaatatggattgcacaggaactgcggcgcattggcgatg
A0A8B9S6H8_PMAIP1-      -atgcag------------------------ctgcgccgcatcggggaca
                            **                          ***   **** *  **  

A0A8B9NX34_BMF-01       agtttcac-----cggctccacgtacagaggcatcagcagaacagaaatc
A0A8B9NX34_BMF-02       agtttcac-----cggctccacgtacagagg-------------------
A0A8B9QMZ1_BCL2L11      aattcaatgcctcctattgtccgagaagggtaattttcaga---------
A0A8B9S6H8_PMAIP1-      agtggaac--------ctgcgccagaaga---------------------
                        * *   *          *   *    **                      

A0A8B9NX34_BMF-01       aagtgtggtggcagctttttctctttctacacaacttggccttaaatggg
A0A8B9NX34_BMF-02       --------------------------------------------------
A0A8B9QMZ1_BCL2L11      ------------------tttttcttctccatctctttctgt--------
A0A8B9S6H8_PMAIP1-      ------------------------tcctcaacctcctc------------
                                                                          

A0A8B9NX34_BMF-01       gaggcgaacaggaaccacactgggcagaggcaaaattgtttctgtaagag
A0A8B9NX34_BMF-02       --------------ctacccttgccaaaggcaaa----------------
A0A8B9QMZ1_BCL2L11      --------------gcagtctctaaaagggaaaa----------------
A0A8B9S6H8_PMAIP1-      -----------------------------gcaaa----------------
                                                     * ***                

A0A8B9NX34_BMF-01       cattcttcaaaaccctgcttggagttactggtggctattcagtgtctgca
A0A8B9NX34_BMF-02       --------------------ggaaactttgaggactgcaccacagcagaa
A0A8B9QMZ1_BCL2L11      ---------------------------------gcgtaatcatatctgga
A0A8B9S6H8_PMAIP1-      ---------------------------------gct--gttctgcccgga
                                                          *          * * *

A0A8B9NX34_BMF-01       attgtttgcttccagttcagtga
A0A8B9NX34_BMF-02       ag----------------aataa
A0A8B9QMZ1_BCL2L11      ag---------cgagttctgtag
A0A8B9S6H8_PMAIP1-      ga---------cgtga-------
                                               

© 1998-2022Legal notice