Dataset for CDS BMF of organism Apteryx owenii

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8B9NX34_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Apteryx owenii GN=BMF (length=672 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtagcaggcatcccgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacacgctcctccagttggctttgcattggatccacatctccaagaggagcctcaggaaggccagc
gtgaagcacatgtggaggtgcagattgcacggaagttgcagtgcattgcagaccagtttcaccggctccacgtacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatggggaggcgaacag
gaaccacactgggcagaggcaaaattgtttctgtaagagcattcttcaaaaccctgcttggagttactggtggctattca
gtgtctgcaattgtttgcttccagttcagtga
>gnl|bcl2dbcds|A0A8B9NX34_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Apteryx owenii GN=BMF (length=537 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtagcaggcatcccgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacacgctcctccagttggctttgcattggatccacatctccaagaggagcctcaggaaggccagc
gtgaagcacatgtggaggtgcagattgcacggaagttgcagtgcattgcagaccagtttcaccggctccacgtacagagg
ctacccttgccaaaggcaaaggaaactttgaggactgcaccacagcagaaagaataa
© 1998-2022Legal notice