Dataset for CDS BMF of organism Apteryx owenii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9NX34_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8B9NX34_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggct
                       **************************************************

A0A8B9NX34_BMF-01      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8B9NX34_BMF-02      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                       **************************************************

A0A8B9NX34_BMF-01      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8B9NX34_BMF-02      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
                       **************************************************

A0A8B9NX34_BMF-01      cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
A0A8B9NX34_BMF-02      cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
                       **************************************************

A0A8B9NX34_BMF-01      tagcaggcatcccgagcagcaggacaaggcaactcaaacactcagcccgt
A0A8B9NX34_BMF-02      tagcaggcatcccgagcagcaggacaaggcaactcaaacactcagcccgt
                       **************************************************

A0A8B9NX34_BMF-01      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8B9NX34_BMF-02      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
                       **************************************************

A0A8B9NX34_BMF-01      cggagactcttctatgggaatgctggttaccgtttacacgctcctccagt
A0A8B9NX34_BMF-02      cggagactcttctatgggaatgctggttaccgtttacacgctcctccagt
                       **************************************************

A0A8B9NX34_BMF-01      tggctttgcattggatccacatctccaagaggagcctcaggaaggccagc
A0A8B9NX34_BMF-02      tggctttgcattggatccacatctccaagaggagcctcaggaaggccagc
                       **************************************************

A0A8B9NX34_BMF-01      gtgaagcacatgtggaggtgcagattgcacggaagttgcagtgcattgca
A0A8B9NX34_BMF-02      gtgaagcacatgtggaggtgcagattgcacggaagttgcagtgcattgca
                       **************************************************

A0A8B9NX34_BMF-01      gaccagtttcaccggctccacgtacagaggcatcagcagaacagaaatca
A0A8B9NX34_BMF-02      gaccagtttcaccggctccacgtacagagg--------------------
                       ******************************                    

A0A8B9NX34_BMF-01      agtgtggtggcagctttttctctttctacacaacttggccttaaatgggg
A0A8B9NX34_BMF-02      --------------------------------------------------
                                                                         

A0A8B9NX34_BMF-01      aggcgaacaggaaccacactgggcagaggcaaaattgtttctgtaagagc
A0A8B9NX34_BMF-02      -------------ctacccttgccaaaggcaaa-----------------
                                    * ** ** * ** *******                 

A0A8B9NX34_BMF-01      attcttcaaaaccctgcttggagttactggtggctattcagtgtctgcaa
A0A8B9NX34_BMF-02      -------------------ggaaactttgaggactgcaccacagcagaaa
                                          ***     **  * **   *     * * **

A0A8B9NX34_BMF-01      ttgtttgcttccagttcagtga
A0A8B9NX34_BMF-02      g----------------aataa
                                        * * *

© 1998-2022Legal notice