Dataset for CDS BCL2L11 of organism Anas zonorhyncha

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8B9VVW8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL2L11 (length=399 residues).
ctgcaccaggcagaagaaatacagccagaaatatggattgcacaggagctgcggcgcattggagatgaattcaatgcctc
ctattgtccaagaagggtaattttcttatttttactttccatttctttacacttagtctctaaaagggaaaagcttaatc
atatctggaaactagctctgcggcaagtgtttcgttcactcaaatgtagaaaaggatgcgcgggtggttgcattcacccg
ggtgcaggggcgtgctgcctgcgttgcggagttgcccgctgttgcagtgtcactaaacgcactcagagtcaccagcgagt
tgggaccggagacttccagttatcgcagctttgttcccagtaccaagagccagtaaagcatggtctgctgctgggttag
>gnl|bcl2dbcds|A0A8B9VXZ3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL2L11 (length=321 residues).
tcctcctcctcgccgtcgtcgtcgtcggccgccgcccggcccgtctctccctgcagcccgccgcgggctcagccgccgcc
cgccagccccggcccgttcgccacccgctcgccgctcttcatcttcgccgagcgcagccccgcgcccatgagctgcgaca
aggccacgcagacccccagcccgccctgccaggccgtcagccactacctgagcgccatgggtgacttaatgcaagtttca
caaccttgtgtagcaaacacacgtggcaccgccagacaaggatgctggagttgtgcagcatggaggcgcgggtggttttg
a
© 1998-2022Legal notice