Dataset for CDS BCL2L11 of organism Anas zonorhyncha

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9VVW8_BCL2L11      --ctgcaccaggcagaagaaat--------acagccagaaatatggattg
A0A8B9VXZ3_BCL2L11      tcctcctcctcgccgtcgtcgtcgtcggccgccgcccggcccgtctctc-
                          ** * **  ** *  *   *         * *** *     *   *  

A0A8B9VVW8_BCL2L11      cacaggagctgcggcgcattggagatgaattcaatgcctcctattgtcca
A0A8B9VXZ3_BCL2L11      -------cctgcagcccgccgcgggctcagccgccgcccgcca--gcccc
                                **** ** *   *  *    *  *   ***  * *  * ** 

A0A8B9VVW8_BCL2L11      agaagggtaattttcttatttttactttccatttctttacac-ttagtct
A0A8B9VXZ3_BCL2L11      gg--------------------------cccgttcgccacccgctcgccg
                         *                          **  ***   ** *  * * * 

A0A8B9VVW8_BCL2L11      ctaaaagggaaaagcttaatcatatctggaaactagctctgcggcaagtg
A0A8B9VXZ3_BCL2L11      ct------------cttcatcttcgccgagcgc-agccccgcgccca---
                        **            *** *** *  * *    * *** * *** * *   

A0A8B9VVW8_BCL2L11      tttcgttcactcaaatgtagaaaaggatgcgcgggtggttgcattcaccc
A0A8B9VXZ3_BCL2L11      ----------tgagctgc-gacaaggccacgcag------------accc
                                  * *  **  ** ****   *** *            ****

A0A8B9VVW8_BCL2L11      gggtgcaggggcgtgctgcctgcgttgcggagttgcccgctgttgcagtg
A0A8B9VXZ3_BCL2L11      --------------ccagcccgccctgccaggccgtcagccactac----
                                       * *** **  ***   *  * * **   * *    

A0A8B9VVW8_BCL2L11      tcactaaacgcactcagagtcaccagcgagttgggaccggagacttccag
A0A8B9VXZ3_BCL2L11      ------------ctgagcgccatgggtgacttaa-----------tgcaa
                                    ** ** * **   * ** **             * ** 

A0A8B9VVW8_BCL2L11      ttatcgcagctttgtt-----------cccagtaccaagagcca------
A0A8B9VXZ3_BCL2L11      gtttcacaaccttgtgtagcaaacacacgtggcaccgccagacaaggatg
                         * ** ** * ****            *   * ***   ** **      

A0A8B9VVW8_BCL2L11      --------gtaaagcatgg-tctgctgctgggttag-
A0A8B9VXZ3_BCL2L11      ctggagttgtgcagcatggaggcgcgggtggttttga
                                **  *******    ** * *** ** * 

© 1998-2022Legal notice