Dataset for CDS classical BH3-containing proteins of organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

15 sequence(s)

>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=573 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattacccaag
gaggggcttggttgctgcgggagcagctgactcaggactcccacggatagctccagaaacgtgtggcccgtggcagcgtc
acgggatcaagtgcaccagccccgggaggaacgtgctgaaggacagcgctcagtcaggtaccttctgtttgtctaaattg
tgttgtagttgcaaaatgttcaatcctcatttgtttccccctgtcagtttgcgctggcactggcattcacgtctcctgcc
aaatttggggtga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=915 residues).
acacgctcggctggggcagggccggcagcaagcgcgggggaacccggccgggccaccctcgcctttacctgttggagcct
gaaagcgccagcggctgcggctgcggctgcggcgcggcggggcggggcggggcgtgcttgcccgcgcgccggggcgggac
ttagagggggcggagctcgcggtgattgggtgagagccctcggccgccagtctgagctgagctgcggggctgtgcaggtt
tcacttcgctcggcgcagcctccaagtcttggtcttgtgaaagcgctccgtcctgcgtcgccgctgccaccgctgccacc
ggattctcacagtcaccctgcgcgcgccagcccaactgcggccagcatcgccgcgggctgctcgcttcgccccgctcccg
ccgccaccccctcggcgccctttccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaaga
aaaaaagaccaaatggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctga
gaggcctcctcagctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagtt
gtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcag
tctcaggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgc
atattacccaaggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttac
gttacatcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=993 residues).
ccggccacttggggcggcgggagccgccaaggctcgcgcggcgtccgggccgggacagaggcggggcgggcagggggagc
cggggcagctcgggtccgcgagactcccgccgcggtcgcagccggggccgccttcggaggcgagtttgtcaacaatcgcc
tcgcctttggcggcctgacccgtaggcgccgcctccgccggcggcggctattggctgtggcgcggagcgaccgcgcacgg
gccaattgggagcgcgggcacccggcgccagcggcgcggggaggtcggcggtgccggcggcggcgggcgcagtgcgcgag
gaggagcgggaggancgcggaggccctcggctgcccggcggagcgcggcggcgggcgggcggccagtggccggctctgcg
ctgccccgggggctctgaacgcgagtcccgggtattgtctcctgcgctcccttcgtgctgacggtcagggggctccgggt
cggcgaaggacgcgggcaggacgccgcggggcccgggcccgggcccggacgcgacgatcggaagggaaggggcggacaaa
aaaagaccaaatggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgaga
ggcctcctcagctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgt
gacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtc
tcaggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcat
attacccaaggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgt
tacatcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=585 residues).
atggggccggagtggggaacgcggccagccgcctgcaatcgctgcatctgcgcccgctcctgtgctccagcgcagtatct
gatcccgggaagtcagagcccgctgggagtttccgacttctgcaagtcggctctgagcaaagagcacataaaaaaagacc
aaatggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcct
cagctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatc
aacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctg
tacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattaccca
aggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgttacatcgt
ccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagcccaggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgtta
catcgtccgcctggtgtggagattgcagcga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagcccaggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagcttccatgaggcagtctcaggctgtacctgccgata
tgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattacccaaggaggctggca
agaattccagcatcctacctctgc
>gnl|bcl2dbcds|A0A7N5JEA5_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=PMAIP1 (length=165 residues).
atgcctgggaagaaagcgcgtaagagcgcgcaggcgagtcctgcgcggaccccggcagagcccgaagtggagtgcgccat
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttccgctcaggaa
cctga
>gnl|bcl2dbcds|A0A7N5JI49_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BMF (length=702 residues).
atgtttccaagggaagctgggctctttccctccttcccaattgagtgggcgccaagcccccgagtgctcgtcacgctgga
ccctggcgcggagccctggcatcacgactcggaggccgagactctctcctggagtcacccaggggagatggagccgcctc
agtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgggagcttgctgtct
gctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcacccactgctgtggccc
tgggcttcgacccaccagccaggaagacaaggccacccagaccctgagcccggcctccccgagtcagggtgtcatgctgc
cttgtggggtgactgaagaaccccagcgactcttttatggcaacgcaggctaccggctccctctccctgccagtttccct
gcaggcttgccccttggggagcagcccccagaagggccgtggcaacatcgagcagaggtacagattgcccgaaagcttca
gtgcattgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcaggtcctgc
ttttcctacacaacctcgctttgaacgcagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A7N5JI49_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BMF (length=786 residues).
atgccccgagcgggcgtattttggaaacaataccgcgcggttcacagtggcctcctcccgcgccagccagccagctgccg
ccgccgcccctgcccgtgcctcccgccacccgccacccgccgcggcccgtgggcgccaagcccccgagtgctcgtcacgc
tggaccctggcgcggagccctggcatcacgactcggaggccgagactctctcctggagtcacccaggggagatggagccg
cctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgggagcttgct
gtctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcacccactgctgtg
gccctgggcttcgacccaccagccaggaagacaaggccacccagaccctgagcccggcctccccgagtcagggtgtcatg
ctgccttgtggggtgactgaagaaccccagcgactcttttatggcaacgcaggctaccggctccctctccctgccagttt
ccctgcaggcttgccccttggggagcagcccccagaagggccgtggcaacatcgagcagaggtacagattgcccgaaagc
ttcagtgcattgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcaggtc
ctgcttttcctacacaacctcgctttgaacgcagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A7N5JI49_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BMF (length=594 residues).
atgagagcttggtggttactcctcagggcagtgagggagatggagccgcctcagtgtgtggaggagctggaggatgatgt
gttccagccagaggatggggagccggggacccagcctgggagcttgctgtctgctgacctgtttgcccagagccagctgg
actgccccctcagccgtctgcatctcttccctctcacccactgctgtggccctgggcttcgacccaccagccaggaagac
aaggccacccagaccctgagcccggcctccccgagtcagggtgtcatgctgccttgtggggtgactgaagaaccccagcg
actcttttatggcaacgcaggctaccggctccctctccctgccagtttccctgcaggcttgccccttggggagcagcccc
cagaagggccgtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccaccggctt
cacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcaggtcctgcttttcctacacaacctcgctttgaacgc
agatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A7N5KDU2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BIK (length=846 residues).
atgggcatggaaaaaagcaccgtggcctcaggactccttggagggcgaatgggacaatcctgtcaagatcctggatcgta
tacccaaattcagccattggattcgtccaccagtactccgtggcgcctactaaatgcaccgccgtgctgggaaactgcac
tcgcagacggcggggcgcagacagctcacacattcacccagccgccgagaacccgtggtcggggatccggagcggcgggg
cgggagcggcggccccgggggcgggccggggcggggccggcggtttataaactcgcgcgccggccggaggccgcagacaa
tacggctcccggctcgagcgctccggccgccaccatcgccgccaccgccgccgccacctccgacgcgagagaagaaatgt
cccacacaggacccctctccaggaacctctttttgagcaccttcctgcaggagcatggcccggaagttctggaggttccg
ggcatgactgatctcgtggaatactatgatccagggccctcccctaacagcaacaaccccgacgatgtggccatgcggct
ggccttcatcggggacgagatggaagtgagatggatgcttccccgcgttggcgagctgcccgggatggccatgtacagct
tggcttttacctacaaccagacaggcctgagaggtgttcttcgaagtctcgtggacggactcactaacctcagggagaat
gtaaggatctggagtttcctgaccttcaggaacagggtgtccccccacccggggcgcgggctggtgctgtccctgctgct
gctgctggggctgctgctaggctgggggttccgcctcctccagtga
>gnl|bcl2dbcds|A0A7N5KJL4_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BBC3 (length=555 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgcccctttcccct
cagccgcctggtgccctcagccgtctcctgcggcctctgtgagcccggcctgcccgccgcccccgccgcccccgccctgc
tgcccgctgcctacctctgccacagactgcggggcggctcagaagggggtggggcaggaaggcatctcccgaatcccagc
cccccaggtcctcagccctcactctcgccggcagagcagcacctggaatcgccggtgcccagtgccccgggggccctggc
gggaggccccacccaggcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggc
ggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggagg
gtcctgtacaatctcatcatgggactcctgccattacccaggggccgcggagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A7N5KJL4_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BBC3 (length=543 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgcccctttcccct
cagccgcctggtgccctcagccgtctcctgcggcctctgtgagcccggcctgcccgccgcccccgccgcccccgccctgc
tgcccgctgcctacctctggcctgcaggggtggtgggtgctgaccacgcgccccctcccccccggcttttcccaggtcct
cagccctcactctcgccggcagagcagcacctggaatcgccggtgcccagtgccccgggggccctggcgggaggccccac
ccaggcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacg
acctcaacgcgctgtacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggagggtcctgtacaat
ctcatcatgggactcctgccattacccaggggccgcggagccccggagatggagcccaattag
>gnl|bcl2dbcds|G1LIZ7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=PMAIP1 (length=162 residues).
atcggctccctgctcagtggggagcctgcttctccctctccctctgccgcaccccctcccgaagtggagtgcgccattca
actcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttccgctcaggaacct
ga
© 1998-2022Legal notice