Dataset for CDS classical BH3-containing proteins of organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|G1LDR8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagcccaggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgtta
catcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|G1LIZ7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=PMAIP1 (length=162 residues).
atgcctgggaagaaagcgcgtaagagcgcgcaggcgagtcctgcgcggacccggggtcagcccgaagtggagtgcgccat
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttccgctcaggaa
cc
>gnl|bcl2dbcds|G1LNV7_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BBC3 (length=456 residues).
ggaagcggggcaagaggggacccgatttcaagaccacaggcacaggtgtggaaactgaggccccgatgtgtgactggagg
gaagcacagactgcggggcggctcagaagggggtggggcaggaaggcatctcccgaatcccagccccccaggtcctcagc
cctcactctcgccggcagagcagcacctggaatcgccggtgcccagtgccccgggggccctggcgggaggccccacccag
gcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacct
caacgcgctgtacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggagggtcctgtacaatctca
tcatgggactcctgccattacccaggggccgcggagccccggagatggagcccaat
>gnl|bcl2dbcds|G1MI17_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAD (length=633 residues).
gtggggaccccagagaatccctcatctgctcccacacatggcccaggcaaaaggaagtcgggaactgatcggcgggagac
gaggaagggacccaggacgaccgcgcttgcccccacagcccagagcatgttccagatcccagagtttgagcccagtgagc
aggaagactccagccctgcagataggggcctgggccccagccccacaggggaccagcccccaggccctggcaagcaccgg
cagacagccccaggcctcctaggggaagctgctcacccccaggggcagccggccagcagcaaccaccatggaggcgctgg
ggctgtggagccccggagtcgccacagctcgtaccccgcggggaccgaagaggatgaagggttggaggaggaagagctca
gccctttccgggggcgctcgagctcagcgccccccaacctctgtgctgcactgcgctatggccgcgagctccggaggatg
agcgacgagttccagggctccttcaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcgacaaagccc
cagctggacgcgcgtcatccagtcctggtgggatcggaacttggggagaggaggctccgccccctcccaatga
© 1998-2020Legal notice