Dataset for CDS classical BH3-containing proteins of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1LIZ7_PMAIP1-01       --------------------------------------------------
G1LDR8_BCL2L11-01      ----atgg--------------------------------caaagcaacc
G1LNV7_BBC3-01         ggaagcgggg---caagaggggacccgattt---------caagaccaca
G1MI17_BAD-01          ----gtggggaccccagagaatccctcatctgctcccacacatggcc-ca
                                                                         

G1LIZ7_PMAIP1-01       ----------------------------------atgcctgggaagaa--
G1LDR8_BCL2L11-01      ttcagatgtaagtt-----ctga---------gtgtgacagagaaggtgg
G1LNV7_BBC3-01         ggcacaggtg---tggaaactgaggccccgatgtgtgactggagggaagc
G1MI17_BAD-01          ggcaaaaggaagtcgggaactga----tcggcgggagacgaggaagggac
                                                           * *      *    

G1LIZ7_PMAIP1-01       ----------------------------------agcgcgta--------
G1LDR8_BCL2L11-01      aca-----actgcagcctgctgagaggcctcctcagctcagg--------
G1LNV7_BBC3-01         aca----gactgcggg----------------gcggctcaga--------
G1MI17_BAD-01          ccaggacgaccgcgctt---------gcccccacagcccagagcatgttc
                                                          ** *           

G1LIZ7_PMAIP1-01       --------agagc-------------------gcgcaggcgagtcct---
G1LDR8_BCL2L11-01      -----cctggggcccctacctctctacagacagagcagcaaggtaat---
G1LNV7_BBC3-01         --------aggg--------ggtg--------gggcaggaaggcatc---
G1MI17_BAD-01          cagatcccagag--------tttgagcccagtgagcaggaagactccagc
                                * *                    * ****            

G1LIZ7_PMAIP1-01       -------------gcgcggaccc-----------ggggtcagcccgaag-
G1LDR8_BCL2L11-01      cctgaaggcgaagg---ggaccgctgcccccaagg----cagccctcagg
G1LNV7_BBC3-01         -------------tcccgaatcccagccccccaggtcctcagccctca--
G1MI17_BAD-01          cctgcagataggggcctgggccccagccccacaggggaccagcccccagg
                                        *   *            *    ******  *  

G1LIZ7_PMAIP1-01       --------------------------------------------------
G1LDR8_BCL2L11-01      gccc-gctggccccaccagc-cagc-ccaggcccttttgc------tacc
G1LNV7_BBC3-01         ctct------cgccggcagagcagcacctggaatcgccgg------tgcc
G1MI17_BAD-01          ccctggcaagcaccggcaga-cagccccaggcctcctaggggaagctgct
                                                                         

G1LIZ7_PMAIP1-01       --------------------------------------------------
G1LDR8_BCL2L11-01      agatccccgcttttcatctttgtgagaagatcctccctgctgtctcgatc
G1LNV7_BBC3-01         cagtgccccgggggc--cctggcgggaggccccacccaggcagc------
G1MI17_BAD-01          ca--cccccaggggcagccggccagcagcaaccaccatggaggc------
                                                                         

G1LIZ7_PMAIP1-01       ----------------------------------------------tgga
G1LDR8_BCL2L11-01      ctccagtgggtatttctcttttgacacagacaggagcccggcacccatga
G1LNV7_BBC3-01         -------------------------------------------cccggga
G1MI17_BAD-01          ----------------------------gctggggctgtggagccccgga
                                                                       **

G1LIZ7_PMAIP1-01       gt------------------------------------------------
G1LDR8_BCL2L11-01      gttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaac
G1LNV7_BBC3-01         gtc----------------------------------cgggg--------
G1MI17_BAD-01          gtcgccacagctcg----------------taccccgcggggaccgaaga
                       **                                                

G1LIZ7_PMAIP1-01       --------------------------------------------------
G1LDR8_BCL2L11-01      cattatctcagtgcaatgg-------------cttccatgaggcagtctc
G1LNV7_BBC3-01         ------------ggaggaggagcagt--------------gggcccggga
G1MI17_BAD-01          ggatgaagggttggaggaggaagagctcagccctttccgggggcgctcga
                                                                         

G1LIZ7_PMAIP1-01       -----gcgccattc-------------------------------aactc
G1LDR8_BCL2L11-01      aggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttg
G1LNV7_BBC3-01         gatcggggccc----------------------------------agctg
G1MI17_BAD-01          gctcagcgccccccaacctctgtgctgcactgcgctatggccgcgagctc
                            *  **                                   *  * 

G1LIZ7_PMAIP1-01       aggagatttggagacaa----------------actgaatttc-------
G1LDR8_BCL2L11-01      cggcgtattggagacga------------atttaatgcata---ttaccc
G1LNV7_BBC3-01         cggcggatggcggacga------------cctcaacgcgct-----gtac
G1MI17_BAD-01          cggaggatgagcgacgagttccagggctccttcaagggacttcctcgccc
                        ** *  *    *** *                *  *             

G1LIZ7_PMAIP1-01       -----------------------------cggcagaaac-----------
G1LDR8_BCL2L11-01      aaggagggtctttctgaataattaccaagcagccgaagcccaccccc---
G1LNV7_BBC3-01         gagcgg-------cggagaca-agaggagcggcagcgacaccgcccctca
G1MI17_BAD-01          gaagag-------cgcgggcacagcgacgcagatgcgacaaagcccc---
                                                    * *  *   *           

G1LIZ7_PMAIP1-01       ttctgaat-------------ctgatatccaaactcttcc----------
G1LDR8_BCL2L11-01      ----aaatg------------attatcttgcgactgttacgttacatcgt
G1LNV7_BBC3-01         ccctggagggtcctgtacaatctcatcatgggactcctgc----cattac
G1MI17_BAD-01          agctggacg------------cgcgtcat----------c----cagt-c
                             *                  *             *          

G1LIZ7_PMAIP1-01       ------gctcaggaacc--------------------------------
G1LDR8_BCL2L11-01      ccgcctggtgtggagattg------------------------cagtga
G1LNV7_BBC3-01         ccaggggccgcggagccccggagatggag------------cccaat--
G1MI17_BAD-01          ctggtgggatcggaacttggggagaggaggctccgccccctcccaatga
                             *    ***                                   

© 1998-2020Legal notice