Dataset for CDS classical BH3-containing proteins of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ------------------------------------------atggggcc
A0A7N5JE15_BCL2L11      ccggccacttggggcggcgggagccgccaaggctcgcgcggcgtccgggc
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ---------------------------acacgctcggctggggcagggcc
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggagtggggaacgcggccagccg---------------------------
A0A7N5JE15_BCL2L11      cgggacagaggcggggcgggcagggggagccggggcagctcgggtccgcg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggcagcaagcgcgggggaacccggccgggccaccctcgcctttacctgtt
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      -----cctgcaatcgctgcatctgcgcccgc-------------------
A0A7N5JE15_BCL2L11      agactcccgccgcggtcgcagccggggccgccttcggaggcgagtttgtc
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggagcctgaaagcgccagcggctgcggctgc-------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      aacaatcgcctcgcctttggcggcctgacccgtaggcgccgcctccgccg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------tcctgtgctccagcgcagtatctgatcccg
A0A7N5JE15_BCL2L11      gcggcggctattggctgtggcgcggagcgaccgcgcacgggccaattggg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ------------ggctgcggcgcggcggggcggggcggggcgtgcttgcc
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      gg------------------------------------------------
A0A7N5JE15_BCL2L11      agcgcgggcacccggcgccagcggcgcggggaggtcggcggtgccggcgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cgcgcgccggggcgggacttagagggggcggagctcgcggtgattgg---
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cggcgggcgcagtgcgcgaggaggagcgggaggancgcggaggccctcgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ------------------------------------gtgagagccctcgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       -------atgggcatggaaaaaagcaccgtggcctcaggactccttggag
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------atgtttccaagggaagc-------------------------
A0A7N5JI49_BMF-02       --------atgccccgagcgggcgtattttggaaacaataccgcgcggtt
A0A7N5JI49_BMF-03       --------atg---------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ----aagtcagagcccgctgggagtttccgacttctgcaagtcggctctg
A0A7N5JE15_BCL2L11      ctgcccggcggagcgcggcggcggg--cgggcggccagtggccggctctg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ccgccagtctgagctgagctgcggggctgtgcaggtttcacttcgctcgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       ggcgaatgggacaatcctgtcaagatcctggatcgtatacccaaattcag
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       -----tgggctctttccctccttcccaattga------------------
A0A7N5JI49_BMF-02       cacagtggcctcctcccgcgccagccagccagctgccgccgccgcccctg
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      agc-----------------------------------------------
A0A7N5JE15_BCL2L11      cgctgccccgggggctctg-----------------aacgcgagtcccgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cgcagcctccaagtcttggtcttgtgaaagcgctccgtcctgcgtcgccg
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       ccattggattcgtccaccagtactccgtggcgcctactaaatgcaccgcc
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       ------------------------------------gtgggcgccaagcc
A0A7N5JI49_BMF-02       cccgtgcctcccgccacccgccacccgccgcggcccgtgggcgccaagcc
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      gtattgtctcctgcgctcccttcgtgctgacggtcagggggctccgggtc
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ctgccaccgctgccaccggattctcacagtcaccctgcgcgcgccagccc
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       gtgctgggaaactgcactcgcagacggcggggc-----------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       cccgagtgctcgtcacgctggaccctggc---------------------
A0A7N5JI49_BMF-02       cccgagtgctcgtcacgctggaccctggc---------------------
A0A7N5JI49_BMF-03       -------------------agagcttggt---------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggcgaaggacgcgggcaggacgccgcggggcccgggcccgggcccggacg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      aactgcggccagcatcgccgcgggctgctcgcttcgccccgctcccgccg
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cgacgatcg-----------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ccaccccctcggcgccctttccctggccctcgtccccccaatgtctgact
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       ---------------gcagacagctcacacattcacccagccgccgagaa
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       ---------------gcggagccctggcatcacgactcggaggccgagac
A0A7N5JI49_BMF-02       ---------------gcggagccctggcatcacgactcggaggccgagac
A0A7N5JI49_BMF-03       ---------------g------------gttactcctcag-ggcagtga-
A0A7N5KJL4_BBC3-01      ---------------------------------------atggcccgagc
A0A7N5KJL4_BBC3-02      ---------------------------------------atggcccgagc
A0A7N5JE15_BCL2L11      ---------------------------------------atggcaaagca
A0A7N5JE15_BCL2L11      ---------------------------------------atggcaaagca
A0A7N5JE15_BCL2L11      ---------------aaagagcacataaaaaaagaccaaatggcaaagca
A0A7N5JE15_BCL2L11      ---------gaagggaaggggcggacaaaaaaagaccaaatggcaaagca
A0A7N5JE15_BCL2L11      ---------------------------------------atggcaaagca
A0A7N5JE15_BCL2L11      ctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaagca
A0A7N5JE15_BCL2L11      ---------------------------------------atggcaaagca
                                                                          

A0A7N5KDU2_BIK-01       cccgtggtcggggatccggagcggcggggcgggagcggcggccccggggg
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       tctctcctggagtcacccaggggagatggagccgcctcagtgtgtggagg
A0A7N5JI49_BMF-02       tctctcctggagtcacccaggggagatggagccgcctcagtgtgtggagg
A0A7N5JI49_BMF-03       --------------------gggagatggagccgcctcagtgtgtggagg
A0A7N5KJL4_BBC3-01      acgcca-----------------ggagggcagctccccggagcccg-tag
A0A7N5KJL4_BBC3-02      acgcca-----------------ggagggcagctccccggagcccg-tag
A0A7N5JE15_BCL2L11      accttc-----------------agatgtaagttct---gagtgtgacag
A0A7N5JE15_BCL2L11      accttc-----------------agatgtaagttct---gagtgtgacag
A0A7N5JE15_BCL2L11      accttc-----------------agatgtaagttct---gagtgtgacag
A0A7N5JE15_BCL2L11      accttc-----------------agatgtaagttct---gagtgtgacag
A0A7N5JE15_BCL2L11      accttc-----------------agatgtaagttct---gagtgtgacag
A0A7N5JE15_BCL2L11      accttc-----------------agatgtaagttct---gagtgtgacag
A0A7N5JE15_BCL2L11      accttc-----------------agatgtaagttct---gagtgtgacag
                                                                          

A0A7N5KDU2_BIK-01       cgggccggggcggggccggcggtttataaactcgcgcgccggccggaggc
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       agctggaggatgatgtgttccagccagaggatggggagccggggacccag
A0A7N5JI49_BMF-02       agctggaggatgatgtgttccagccagaggatggggagccggggacccag
A0A7N5JI49_BMF-03       agctggaggatgatgtgttccagccagaggatggggagccggggacccag
A0A7N5KJL4_BBC3-01      ag----------------------------------------------gg
A0A7N5KJL4_BBC3-02      ag----------------------------------------------gg
A0A7N5JE15_BCL2L11      ag----------------------------------------------aa
A0A7N5JE15_BCL2L11      ag----------------------------------------------aa
A0A7N5JE15_BCL2L11      ag----------------------------------------------aa
A0A7N5JE15_BCL2L11      ag----------------------------------------------aa
A0A7N5JE15_BCL2L11      ag----------------------------------------------aa
A0A7N5JE15_BCL2L11      ag----------------------------------------------aa
A0A7N5JE15_BCL2L11      ag----------------------------------------------aa
                                                                          

A0A7N5KDU2_BIK-01       cgcagacaatacggctcccggctcgagcgctccggccgccaccatcgccg
A0A7N5JEA5_PMAIP1-      -------a-------tgcctggg-aagaaagcgcgtaagagcg-------
G1LIZ7_PMAIP1-01        -------a--tcggctccctgct-cagtggg-------gagcc-------
A0A7N5JI49_BMF-01       cctgggag--cttgctgtctgct-gacctgtttgcccagagccagctgga
A0A7N5JI49_BMF-02       cctgggag--cttgctgtctgct-gacctgtttgcccagagccagctgga
A0A7N5JI49_BMF-03       cctgggag--cttgctgtctgct-gacctgtttgcccagagccagctgga
A0A7N5KJL4_BBC3-01      cctggccc--gcgacggcccgc------gcccctttccc-----------
A0A7N5KJL4_BBC3-02      cctggccc--gcgacggcccgc------gcccctttccc-----------
A0A7N5JE15_BCL2L11      ggtggaca--actgcagcctgct-gagaggcctcctcag-----------
A0A7N5JE15_BCL2L11      ggtggaca--actgcagcctgct-gagaggcctcctcag-----------
A0A7N5JE15_BCL2L11      ggtggaca--actgcagcctgct-gagaggcctcctcag-----------
A0A7N5JE15_BCL2L11      ggtggaca--actgcagcctgct-gagaggcctcctcag-----------
A0A7N5JE15_BCL2L11      ggtggaca--actgcagcctgct-gagaggcctcctcag-----------
A0A7N5JE15_BCL2L11      ggtggaca--actgcagcctgct-gagaggcctcctcag-----------
A0A7N5JE15_BCL2L11      ggtggaca--actgcagcctgct-gagaggcctcctcag-----------
                                          * *                             

A0A7N5KDU2_BIK-01       ccaccgccgccgccacctccgacgcgagagaagaaatgtcccacacagga
A0A7N5JEA5_PMAIP1-      -------cgcaggcgagtcctgcgc----------------------gga
G1LIZ7_PMAIP1-01        -------tgc-------ttctccct----------------------ctc
A0A7N5JI49_BMF-01       ctgccccctcagccgtctgcatctc----------------------ttc
A0A7N5JI49_BMF-02       ctgccccctcagccgtctgcatctc----------------------ttc
A0A7N5JI49_BMF-03       ctgccccctcagccgtctgcatctc----------------------ttc
A0A7N5KJL4_BBC3-01      -------ctcagccgcctggtgccc----------------------tca
A0A7N5KJL4_BBC3-02      -------ctcagccgcctggtgccc----------------------tca
A0A7N5JE15_BCL2L11      -------ctcag--gcctggggccc----------------------cta
A0A7N5JE15_BCL2L11      -------ctcag--gcctggggccc----------------------cta
A0A7N5JE15_BCL2L11      -------ctcag--gcctggggccc----------------------cta
A0A7N5JE15_BCL2L11      -------ctcag--gcctggggccc----------------------cta
A0A7N5JE15_BCL2L11      -------ctcag--gcctggggccc----------------------cta
A0A7N5JE15_BCL2L11      -------ctcag--gcctggggccc----------------------cta
A0A7N5JE15_BCL2L11      -------ctcag--gcctggggccc----------------------cta
                                 *       *    *                           

A0A7N5KDU2_BIK-01       cccctctccaggaacctcttt----ttgagcacct---------------
A0A7N5JEA5_PMAIP1-      ccccg---------------------------------------------
G1LIZ7_PMAIP1-01        cctct---------------------------------------------
A0A7N5JI49_BMF-01       cctctcacc---cactgctgtggccctgggcttcg---------------
A0A7N5JI49_BMF-02       cctctcacc---cactgctgtggccctgggcttcg---------------
A0A7N5JI49_BMF-03       cctctcacc---cactgctgtggccctgggcttcg---------------
A0A7N5KJL4_BBC3-01      gccgtctcctgcggcctctgtgagcccggcctgcc---------------
A0A7N5KJL4_BBC3-02      gccgtctcctgcggcctctgtgagcccggcctgcc---------------
A0A7N5JE15_BCL2L11      cctctctac-------------agacagagcagcaaggtaatcctgaagg
A0A7N5JE15_BCL2L11      cctctctac-------------agacagagcagcaaggtaatcctgaagg
A0A7N5JE15_BCL2L11      cctctctac-------------agacagagcagca---------------
A0A7N5JE15_BCL2L11      cctctctac-------------agacagagcagca---------------
A0A7N5JE15_BCL2L11      cctctctac-------------agacagagcagca---------------
A0A7N5JE15_BCL2L11      cctctctac-------------agacagagcagca---------------
A0A7N5JE15_BCL2L11      cctctctac-------------agacagagcagca---------------
                         *                                                

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      cgaaggggaccgctgcccccaaggcagccctcagggcccgctggccccac
A0A7N5JE15_BCL2L11      cgaaggggaccgctgcccccaaggcagccctcagggcccgctggccccac
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A7N5JE15_BCL2L11      cagccagcccaggcccttttgctaccagatccccgcttttcatctttgtg
A0A7N5JE15_BCL2L11      cagccagcccaggcccttttgctaccagatccccgcttttcatctttgtg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       ---------------------------------------------tcctg
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       -----------------------acccaccagccaggaagacaaggccac
A0A7N5JI49_BMF-02       -----------------------acccaccagccaggaagacaaggccac
A0A7N5JI49_BMF-03       -----------------------acccaccagccaggaagacaaggccac
A0A7N5KJL4_BBC3-01      ----cgccgcccccgccgcccccgccctgctgcccgctgcctacctctgc
A0A7N5KJL4_BBC3-02      ----cgccgcccccgccgcccccgccctgctgcccgctgcctacctctg-
A0A7N5JE15_BCL2L11      agaagatcctccctgctgtctcgatcctccagtgggtatttctcttttga
A0A7N5JE15_BCL2L11      agaagatcctccctgctgtctcgatcctccagtgggtatttctcttttga
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       caggagcatggcccggaagttctggaggttccgggcatgactgatctcgt
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       ccagaccctgagcccggcctccccgagtcagggtgtcatgctgccttgtg
A0A7N5JI49_BMF-02       ccagaccctgagcccggcctccccgagtcagggtgtcatgctgccttgtg
A0A7N5JI49_BMF-03       ccagaccctgagcccggcctccccgagtcagggtgtcatgctgccttgtg
A0A7N5KJL4_BBC3-01      cacagactgcggggcggctcagaag-gggg----------------tggg
A0A7N5KJL4_BBC3-02      ----gcctgcagg-----------g-gtgg----------------tggg
A0A7N5JE15_BCL2L11      cacagacaggagcccggcacccatgagttg----------------tgac
A0A7N5JE15_BCL2L11      cacagacaggagcccggcacccatgagttg----------------tgac
A0A7N5JE15_BCL2L11      ---agacaggagcccggcacccatgagttg----------------tgac
A0A7N5JE15_BCL2L11      ---agacaggagcccggcacccatgagttg----------------tgac
A0A7N5JE15_BCL2L11      ---agacaggagcccggcacccatgagttg----------------tgac
A0A7N5JE15_BCL2L11      ---agacaggagcccggcacccatgagttg----------------tgac
A0A7N5JE15_BCL2L11      ---a----------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       ggaatactatg-atccagggccctcccctaacagcaacaaccccgacgat
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       gggtgactgaagaaccccagcgactcttttatggcaacg-----------
A0A7N5JI49_BMF-02       gggtgactgaagaaccccagcgactcttttatggcaacg-----------
A0A7N5JI49_BMF-03       gggtgactgaagaaccccagcgactcttttatggcaacg-----------
A0A7N5KJL4_BBC3-01      gcagga--aggcatctcccgaatcccagc--cccc---------------
A0A7N5KJL4_BBC3-02      tgctgaccacgcgccccctcccccccggcttttcc---------------
A0A7N5JE15_BCL2L11      aaatcaacacaaaccccaagtcctcc-----ttgc---------------
A0A7N5JE15_BCL2L11      aaatcaacacaaaccccaagtcctcc-----ttgc---------------
A0A7N5JE15_BCL2L11      aaatcaacacaaaccccaagtcctcc-----ttgc---------------
A0A7N5JE15_BCL2L11      aaatcaacacaaaccccaagtcctcc-----ttgc---------------
A0A7N5JE15_BCL2L11      aaatcaacacaaaccccaagtcctcc-----ttgc---------------
A0A7N5JE15_BCL2L11      aaatcaacacaaaccccaagtcctcc-----ttgc---------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       gtggccatgcggctggccttcatcggggacgagatggaagtgagatggat
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       -----caggctaccggctccct----------------------------
A0A7N5JI49_BMF-02       -----caggctaccggctccct----------------------------
A0A7N5JI49_BMF-03       -----caggctaccggctccct----------------------------
A0A7N5KJL4_BBC3-01      -----caggtcctcagccctcactctcgccggcagagcagcacctggaat
A0A7N5KJL4_BBC3-02      -----caggtcctcagccctcactctcgccggcagagcagcacctggaat
A0A7N5JE15_BCL2L11      -----caggccttcaaccattat---------------------------
A0A7N5JE15_BCL2L11      -----caggccttcaaccattat---------------------------
A0A7N5JE15_BCL2L11      -----caggccttcaaccattat---------------------------
A0A7N5JE15_BCL2L11      -----caggccttcaaccattat---------------------------
A0A7N5JE15_BCL2L11      -----caggccttcaaccattat---------------------------
A0A7N5JE15_BCL2L11      -----caggccttcaaccattat---------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --------------------gcttccccg----------cgttggcgagc
A0A7N5JEA5_PMAIP1-      ------------------------------------------------gc
G1LIZ7_PMAIP1-01        ------------------------------------------------gc
A0A7N5JI49_BMF-01       --------ctccctgcca--gtttccctgcaggcttgccccttggggagc
A0A7N5JI49_BMF-02       --------ctccctgcca--gtttccctgcaggcttgccccttggggagc
A0A7N5JI49_BMF-03       --------ctccctgcca--gtttccctgcaggcttgccccttggggagc
A0A7N5KJL4_BBC3-01      cgccggtgcccagtgccccgggggccctggcgggaggccccacccag-gc
A0A7N5KJL4_BBC3-02      cgccggtgcccagtgccccgggggccctggcgggaggccccacccag-gc
A0A7N5JE15_BCL2L11      --------ctcagtgcaatggcttccatg----------------ag-gc
A0A7N5JE15_BCL2L11      --------ctcagtgcaatggcttccatg----------------ag-gc
A0A7N5JE15_BCL2L11      --------ctcagtgcaatggcttccatg----------------ag-gc
A0A7N5JE15_BCL2L11      --------ctcagtgcaatggcttccatg----------------ag-gc
A0A7N5JE15_BCL2L11      --------ctcagtgcaatggcttccatg----------------ag-gc
A0A7N5JE15_BCL2L11      --------ctcagtgcaatggcttccatg----------------ag-gc
A0A7N5JE15_BCL2L11      --------------------gcttccatg----------------ag-gc
                                                                        **

A0A7N5KDU2_BIK-01       tg--cccgggatggccatgtacagcttggcttttacctacaaccagacag
A0A7N5JEA5_PMAIP1-      agag---------------------------------cccgaag---tgg
G1LIZ7_PMAIP1-01        cgcacccc---------------------------ctcccgaag---tgg
A0A7N5JI49_BMF-01       agcccccagaagggccgtggcaac--------at-cgagcagaggtacag
A0A7N5JI49_BMF-02       agcccccagaagggccgtggcaac--------at-cgagcagaggtacag
A0A7N5JI49_BMF-03       agcccccagaagggccgtggcaac--------at-cgagcagaggtacag
A0A7N5KJL4_BBC3-01      ag-ccccggga-gtccggggggaggaggagcagtgggcccggg-----ag
A0A7N5KJL4_BBC3-02      ag-ccccggga-gtccggggggaggaggagcagtgggcccggg-----ag
A0A7N5JE15_BCL2L11      ag-tctcaggctgtacctgccgat--------atgcgcccggagatatgg
A0A7N5JE15_BCL2L11      ag-tctcaggctgtacctgccgat--------atgcgcccggagatatgg
A0A7N5JE15_BCL2L11      ag-tctcaggctgtacctgccgat--------atgcgcccggagatatgg
A0A7N5JE15_BCL2L11      ag-tctcaggctgtacctgccgat--------atgcgcccggagatatgg
A0A7N5JE15_BCL2L11      ag-tctcaggctgtacctgccgat--------atgcgcccggagatatgg
A0A7N5JE15_BCL2L11      ag-tctcaggctgtacctgccgat--------atgcgcccggagatatgg
A0A7N5JE15_BCL2L11      ag-tctcaggctgtacctgccgat--------atgcgcccggagatatgg
                         *                                     *         *

A0A7N5KDU2_BIK-01       gcctgagaggtgttcttcgaagtctcgtggacggactc-actaacctca-
A0A7N5JEA5_PMAIP1-      agtgcgccattcaactcaggagatttggagacaaactgaatttccggca-
G1LIZ7_PMAIP1-01        agtgcgccattcaactcaggagatttggagacaaactgaatttccggca-
A0A7N5JI49_BMF-01       attgcccga--aagcttcagtgcattgcagaccagttccaccggcttcac
A0A7N5JI49_BMF-02       attgcccga--aagcttcagtgcattgcagaccagttccaccggcttcac
A0A7N5JI49_BMF-03       attgcccga--aagcttcagtgcattgcagaccagttccaccggcttcac
A0A7N5KJL4_BBC3-01      atcggggcc--cagctgcggcggatggcggacgacctcaacgcgctgtac
A0A7N5KJL4_BBC3-02      atcggggcc--cagctgcggcggatggcggacgacctcaacgcgctgtac
A0A7N5JE15_BCL2L11      attgcgcaa--gagttgcggcgtattggagacgaatttaatgcatattac
A0A7N5JE15_BCL2L11      attgcgcaa--gagttgcggcgtattggagacgaatttaatgcatattac
A0A7N5JE15_BCL2L11      attgcgcaa--gagttgcggcgtattggagacgaatttaatgcatattac
A0A7N5JE15_BCL2L11      attgcgcaa--gagttgcggcgtattggagacgaatttaatgcatattac
A0A7N5JE15_BCL2L11      attgcgcaa--gagttgcggcgtattggagacgaatttaatgcatattac
A0A7N5JE15_BCL2L11      attgcgcaa--gagttgcggcgtattggagacgaatttaatgcatattac
A0A7N5JE15_BCL2L11      attgcgcaa--gagttgcggcgtattggagacgaatttaatgcatattac
                                       *     *  * *  ***    *  *        * 

A0A7N5KDU2_BIK-01       gggagaatgtaaggatctggagtttcctgaccttcaggaacagggtgtcc
A0A7N5JEA5_PMAIP1-      ---------------------------gaaacttctgaatc---------
G1LIZ7_PMAIP1-01        ---------------------------gaaacttctgaatc---------
A0A7N5JI49_BMF-01       atgc-------------------------agcaacaccagcaaaa-----
A0A7N5JI49_BMF-02       atgc-------------------------agcaacaccagcaaaa-----
A0A7N5JI49_BMF-03       atgc-------------------------agcaacaccagcaaaa-----
A0A7N5KJL4_BBC3-01      gagcggcgg-------------agacaagaggagcggcagcgacaccgcc
A0A7N5KJL4_BBC3-02      gagcggcgg-------------agacaagaggagcggcagcgacaccgcc
A0A7N5JE15_BCL2L11      ccaaggagggtctttctgaataattaccaagcagccgaagc---------
A0A7N5JE15_BCL2L11      ccaaggaggtt---------------------------------------
A0A7N5JE15_BCL2L11      ccaaggagggtctttctgaataattaccaagcagccgaagc---------
A0A7N5JE15_BCL2L11      ccaaggagggtctttctgaataattaccaagcagccgaagc---------
A0A7N5JE15_BCL2L11      ccaaggaggggct---tggttgctgcgggagcagctgactcaggactccc
A0A7N5JE15_BCL2L11      ccaaggagggtctttctgaataattaccaagcagccgaagc---------
A0A7N5JE15_BCL2L11      ccaaggagg------------------ctggcaa--gaatt---------
                                                                          

A0A7N5KDU2_BIK-01       --------------------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       --------------------------------------------------
A0A7N5JI49_BMF-02       --------------------------------------------------
A0A7N5JI49_BMF-03       --------------------------------------------------
A0A7N5KJL4_BBC3-01      cc------------------------------------------------
A0A7N5KJL4_BBC3-02      cc------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      acggatagctccagaaacgtgtggcccgtggcagcgtcacgggatcaagt
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       ---ccccacccggg-------------------------------gcgcg
A0A7N5JEA5_PMAIP1-      ---tgatatccaaa------------------------------------
G1LIZ7_PMAIP1-01        ---tgatatccaaa------------------------------------
A0A7N5JI49_BMF-01       ---ccaaaatcgag------------------------------------
A0A7N5JI49_BMF-02       ---ccaaaatcgag------------------------------------
A0A7N5JI49_BMF-03       ---ccaaaatcgag------------------------------------
A0A7N5KJL4_BBC3-01      ---tcaccctggag-------------------------ggtcctgtaca
A0A7N5KJL4_BBC3-02      ---tcaccctggag-------------------------ggtcctgtaca
A0A7N5JE15_BCL2L11      ---ccacccccaaa------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ---ccacccccaaa------------------------------------
A0A7N5JE15_BCL2L11      ---ccacccccaaa------------------------------------
A0A7N5JE15_BCL2L11      gcaccagccccgggaggaacgtgctgaaggacagcgctcagtcaggtacc
A0A7N5JE15_BCL2L11      ---ccacccccaaa------------------------------------
A0A7N5JE15_BCL2L11      ---ccagc------------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       ggctggtgctg---------------------------------------
A0A7N5JEA5_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A7N5JI49_BMF-01       -tgtggtggca---------------------------------------
A0A7N5JI49_BMF-02       -tgtggtggca---------------------------------------
A0A7N5JI49_BMF-03       -tgtggtggca---------------------------------------
A0A7N5KJL4_BBC3-01      atctcatcatg---------------------------------------
A0A7N5KJL4_BBC3-02      atctcatcatg---------------------------------------
A0A7N5JE15_BCL2L11      ---tgattatc---------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ---tgattatc---------------------------------------
A0A7N5JE15_BCL2L11      ---tgattatc---------------------------------------
A0A7N5JE15_BCL2L11      ttctgtttgtctaaattgtgttgtagttgcaaaatgttcaatcctcattt
A0A7N5JE15_BCL2L11      ---tgattatc---------------------------------------
A0A7N5JE15_BCL2L11      --------atc---------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       --tccctgctgctgctgctggggctg-----------ctgctaggctggg
A0A7N5JEA5_PMAIP1-      --------ctcttccgctcaggaacc------------------------
G1LIZ7_PMAIP1-01        --------ctcttccgctcaggaacc------------------------
A0A7N5JI49_BMF-01       -ggtcctgcttttcctacacaacctcgctttgaacgcagatgagaacagg
A0A7N5JI49_BMF-02       -ggtcctgcttttcctacacaacctcgctttgaacgcagatgagaacagg
A0A7N5JI49_BMF-03       -ggtcctgcttttcctacacaacctcgctttgaacgcagatgagaacagg
A0A7N5KJL4_BBC3-01      --ggactcctgccattacccaggggc-----------cgcggagccccgg
A0A7N5KJL4_BBC3-02      --ggactcctgccattacccaggggc-----------cgcggagccccgg
A0A7N5JE15_BCL2L11      --ttgcgactgttacgttacatcgtc-----------cgcctggtgtgga
A0A7N5JE15_BCL2L11      -------------------------------------------------a
A0A7N5JE15_BCL2L11      --ttgcgactgttacgttacatcgtc-----------cgcctggtgtgga
A0A7N5JE15_BCL2L11      --ttgcgactgttacgttacatcgtc-----------cgcctggtgtgga
A0A7N5JE15_BCL2L11      gtttccccctgtcagtttgcgctggcactggcattcacgtctcctgccaa
A0A7N5JE15_BCL2L11      --ttgcgactgttacgttacatcgtc-----------cgcctggtgtgga
A0A7N5JE15_BCL2L11      --ctacctctgc--------------------------------------
                                                                          

A0A7N5KDU2_BIK-01       ggttccgcctcctccag-tga
A0A7N5JEA5_PMAIP1-      ------------------tga
G1LIZ7_PMAIP1-01        ------------------tga
A0A7N5JI49_BMF-01       aatggggcaggtcccaggtga
A0A7N5JI49_BMF-02       aatggggcaggtcccaggtga
A0A7N5JI49_BMF-03       aatggggcaggtcccaggtga
A0A7N5KJL4_BBC3-01      agatg----gagcccaattag
A0A7N5KJL4_BBC3-02      agatg----gagcccaattag
A0A7N5JE15_BCL2L11      gattg----cag------cga
A0A7N5JE15_BCL2L11      ga--g----caa------tag
A0A7N5JE15_BCL2L11      gattg----cag------tga
A0A7N5JE15_BCL2L11      gattg----cag------tga
A0A7N5JE15_BCL2L11      atttg----ggg------tga
A0A7N5JE15_BCL2L11      gattg----cag------tga
A0A7N5JE15_BCL2L11      ---------------------
                                             

© 1998-2022Legal notice