Dataset for CDS BMF of organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A7N5JI49_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BMF (length=702 residues).
atgtttccaagggaagctgggctctttccctccttcccaattgagtgggcgccaagcccccgagtgctcgtcacgctgga
ccctggcgcggagccctggcatcacgactcggaggccgagactctctcctggagtcacccaggggagatggagccgcctc
agtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgggagcttgctgtct
gctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcacccactgctgtggccc
tgggcttcgacccaccagccaggaagacaaggccacccagaccctgagcccggcctccccgagtcagggtgtcatgctgc
cttgtggggtgactgaagaaccccagcgactcttttatggcaacgcaggctaccggctccctctccctgccagtttccct
gcaggcttgccccttggggagcagcccccagaagggccgtggcaacatcgagcagaggtacagattgcccgaaagcttca
gtgcattgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcaggtcctgc
ttttcctacacaacctcgctttgaacgcagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A7N5JI49_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BMF (length=786 residues).
atgccccgagcgggcgtattttggaaacaataccgcgcggttcacagtggcctcctcccgcgccagccagccagctgccg
ccgccgcccctgcccgtgcctcccgccacccgccacccgccgcggcccgtgggcgccaagcccccgagtgctcgtcacgc
tggaccctggcgcggagccctggcatcacgactcggaggccgagactctctcctggagtcacccaggggagatggagccg
cctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgggagcttgct
gtctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcacccactgctgtg
gccctgggcttcgacccaccagccaggaagacaaggccacccagaccctgagcccggcctccccgagtcagggtgtcatg
ctgccttgtggggtgactgaagaaccccagcgactcttttatggcaacgcaggctaccggctccctctccctgccagttt
ccctgcaggcttgccccttggggagcagcccccagaagggccgtggcaacatcgagcagaggtacagattgcccgaaagc
ttcagtgcattgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcaggtc
ctgcttttcctacacaacctcgctttgaacgcagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A7N5JI49_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BMF (length=594 residues).
atgagagcttggtggttactcctcagggcagtgagggagatggagccgcctcagtgtgtggaggagctggaggatgatgt
gttccagccagaggatggggagccggggacccagcctgggagcttgctgtctgctgacctgtttgcccagagccagctgg
actgccccctcagccgtctgcatctcttccctctcacccactgctgtggccctgggcttcgacccaccagccaggaagac
aaggccacccagaccctgagcccggcctccccgagtcagggtgtcatgctgccttgtggggtgactgaagaaccccagcg
actcttttatggcaacgcaggctaccggctccctctccctgccagtttccctgcaggcttgccccttggggagcagcccc
cagaagggccgtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccaccggctt
cacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcaggtcctgcttttcctacacaacctcgctttgaacgc
agatgagaacaggaatggggcaggtcccaggtga
© 1998-2022Legal notice