Dataset for CDS BMF of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7N5JI49_BMF-01      atgtttccaagggaagc------------------------------tgg
A0A7N5JI49_BMF-02      atgccccgagcgggcgtattttggaaacaataccgcgcggttcacagtgg
A0A7N5JI49_BMF-03      atg-----------------------------------------------
                       ***                                               

A0A7N5JI49_BMF-01      gctctttccctccttcccaattga--------------------------
A0A7N5JI49_BMF-02      cctcctcccgcgccagccagccagctgccgccgccgcccctgcccgtgcc
A0A7N5JI49_BMF-03      --------------------------------------------------
                                                                         

A0A7N5JI49_BMF-01      ----------------------------gtgggcgccaagcccccgagtg
A0A7N5JI49_BMF-02      tcccgccacccgccacccgccgcggcccgtgggcgccaagcccccgagtg
A0A7N5JI49_BMF-03      --------------------------------------------------
                                                                         

A0A7N5JI49_BMF-01      ctcgtcacgctggaccctggcgcggagccctggcatcacgactcggaggc
A0A7N5JI49_BMF-02      ctcgtcacgctggaccctggcgcggagccctggcatcacgactcggaggc
A0A7N5JI49_BMF-03      -----------agagcttggtg------------gttactcctcag-ggc
                                   ** * *** *             * **  *** * ***

A0A7N5JI49_BMF-01      cgagactctctcctggagtcacccaggggagatggagccgcctcagtgtg
A0A7N5JI49_BMF-02      cgagactctctcctggagtcacccaggggagatggagccgcctcagtgtg
A0A7N5JI49_BMF-03      agtga---------------------gggagatggagccgcctcagtgtg
                        * **                     ************************

A0A7N5JI49_BMF-01      tggaggagctggaggatgatgtgttccagccagaggatggggagccgggg
A0A7N5JI49_BMF-02      tggaggagctggaggatgatgtgttccagccagaggatggggagccgggg
A0A7N5JI49_BMF-03      tggaggagctggaggatgatgtgttccagccagaggatggggagccgggg
                       **************************************************

A0A7N5JI49_BMF-01      acccagcctgggagcttgctgtctgctgacctgtttgcccagagccagct
A0A7N5JI49_BMF-02      acccagcctgggagcttgctgtctgctgacctgtttgcccagagccagct
A0A7N5JI49_BMF-03      acccagcctgggagcttgctgtctgctgacctgtttgcccagagccagct
                       **************************************************

A0A7N5JI49_BMF-01      ggactgccccctcagccgtctgcatctcttccctctcacccactgctgtg
A0A7N5JI49_BMF-02      ggactgccccctcagccgtctgcatctcttccctctcacccactgctgtg
A0A7N5JI49_BMF-03      ggactgccccctcagccgtctgcatctcttccctctcacccactgctgtg
                       **************************************************

A0A7N5JI49_BMF-01      gccctgggcttcgacccaccagccaggaagacaaggccacccagaccctg
A0A7N5JI49_BMF-02      gccctgggcttcgacccaccagccaggaagacaaggccacccagaccctg
A0A7N5JI49_BMF-03      gccctgggcttcgacccaccagccaggaagacaaggccacccagaccctg
                       **************************************************

A0A7N5JI49_BMF-01      agcccggcctccccgagtcagggtgtcatgctgccttgtggggtgactga
A0A7N5JI49_BMF-02      agcccggcctccccgagtcagggtgtcatgctgccttgtggggtgactga
A0A7N5JI49_BMF-03      agcccggcctccccgagtcagggtgtcatgctgccttgtggggtgactga
                       **************************************************

A0A7N5JI49_BMF-01      agaaccccagcgactcttttatggcaacgcaggctaccggctccctctcc
A0A7N5JI49_BMF-02      agaaccccagcgactcttttatggcaacgcaggctaccggctccctctcc
A0A7N5JI49_BMF-03      agaaccccagcgactcttttatggcaacgcaggctaccggctccctctcc
                       **************************************************

A0A7N5JI49_BMF-01      ctgccagtttccctgcaggcttgccccttggggagcagcccccagaaggg
A0A7N5JI49_BMF-02      ctgccagtttccctgcaggcttgccccttggggagcagcccccagaaggg
A0A7N5JI49_BMF-03      ctgccagtttccctgcaggcttgccccttggggagcagcccccagaaggg
                       **************************************************

A0A7N5JI49_BMF-01      ccgtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcat
A0A7N5JI49_BMF-02      ccgtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcat
A0A7N5JI49_BMF-03      ccgtggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcat
                       **************************************************

A0A7N5JI49_BMF-01      tgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaa
A0A7N5JI49_BMF-02      tgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaa
A0A7N5JI49_BMF-03      tgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaa
                       **************************************************

A0A7N5JI49_BMF-01      atcgagtgtggtggcaggtcctgcttttcctacacaacctcgctttgaac
A0A7N5JI49_BMF-02      atcgagtgtggtggcaggtcctgcttttcctacacaacctcgctttgaac
A0A7N5JI49_BMF-03      atcgagtgtggtggcaggtcctgcttttcctacacaacctcgctttgaac
                       **************************************************

A0A7N5JI49_BMF-01      gcagatgagaacaggaatggggcaggtcccaggtga
A0A7N5JI49_BMF-02      gcagatgagaacaggaatggggcaggtcccaggtga
A0A7N5JI49_BMF-03      gcagatgagaacaggaatggggcaggtcccaggtga
                       ************************************

© 1998-2022Legal notice