Dataset for CDS BBC3 of organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A7N5KJL4_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BBC3 (length=555 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgcccctttcccct
cagccgcctggtgccctcagccgtctcctgcggcctctgtgagcccggcctgcccgccgcccccgccgcccccgccctgc
tgcccgctgcctacctctgccacagactgcggggcggctcagaagggggtggggcaggaaggcatctcccgaatcccagc
cccccaggtcctcagccctcactctcgccggcagagcagcacctggaatcgccggtgcccagtgccccgggggccctggc
gggaggccccacccaggcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggc
ggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggagg
gtcctgtacaatctcatcatgggactcctgccattacccaggggccgcggagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A7N5KJL4_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BBC3 (length=543 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgcccctttcccct
cagccgcctggtgccctcagccgtctcctgcggcctctgtgagcccggcctgcccgccgcccccgccgcccccgccctgc
tgcccgctgcctacctctggcctgcaggggtggtgggtgctgaccacgcgccccctcccccccggcttttcccaggtcct
cagccctcactctcgccggcagagcagcacctggaatcgccggtgcccagtgccccgggggccctggcgggaggccccac
ccaggcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacg
acctcaacgcgctgtacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggagggtcctgtacaat
ctcatcatgggactcctgccattacccaggggccgcggagccccggagatggagcccaattag
© 1998-2022Legal notice