Dataset for CDS BBC3 of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1LNV7_BBC3-01      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgac
G1LNV7_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgac
                    ************************************************************

G1LNV7_BBC3-01      ggcccgcgcccctttcccctcagccgcctggtgccctcagccgtctcctgcggcctctgt
G1LNV7_BBC3-02      ggcccgcgcccctttcccctcagccgcctggtgccctcagccgtctcctgcggcctctgt
                    ************************************************************

G1LNV7_BBC3-01      gagcccggcctgcccgccgcccccgccgcccccgccctgctgcccgctgcctacctctgc
G1LNV7_BBC3-02      gagcccggcctgcccgccgcccccgccgcccccgccctgctgcccgctgcctacctctg-
                    *********************************************************** 

G1LNV7_BBC3-01      cacagactgcggggcggctcagaagggggtggggcagga--aggcatctcccgaatccca
G1LNV7_BBC3-02      ----gcctgcagg-----------ggtggtgggtgctgaccacgcgccccctcccccccg
                        * **** **           ** ******    **  * **  * **     *** 

G1LNV7_BBC3-01      gc--cccccaggtcctcagccctcactctcgccggcagagcagcacctggaatcgccggt
G1LNV7_BBC3-02      gcttttcccaggtcctcagccctcactctcgccggcagagcagcacctggaatcgccggt
                    **    ******************************************************

G1LNV7_BBC3-01      gcccagtgccccgggggccctggcgggaggccccacccaggcagccccgggagtccgggg
G1LNV7_BBC3-02      gcccagtgccccgggggccctggcgggaggccccacccaggcagccccgggagtccgggg
                    ************************************************************

G1LNV7_BBC3-01      ggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacct
G1LNV7_BBC3-02      ggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacct
                    ************************************************************

G1LNV7_BBC3-01      caacgcgctgtacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctg
G1LNV7_BBC3-02      caacgcgctgtacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctg
                    ************************************************************

G1LNV7_BBC3-01      gagggtcctgtacaatctcatcatgggactcctgccattacccaggggccgcggagcccc
G1LNV7_BBC3-02      gagggtcctgtacaatctcatcatgggactcctgccattacccaggggccgcggagcccc
                    ************************************************************

G1LNV7_BBC3-01      ggagatggagcccaattag
G1LNV7_BBC3-02      ggagatggagcccaattag
                    *******************

© 1998-2021Legal notice