Dataset for CDS BAD of organism Accipiter nisus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8B9NIC6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Accipiter nisus GN=BAD (length=453 residues).
atgttcagcctggaggagttcccggaggagcccggctccccccccgcctccccctgggggggttcgcccccccccattgc
atttgacggggggtaccatggtggggtgacgtggagatccctgacacccccccttctttatttgtgccccccctcctccc
caatttttccagaggggcggggccggctgggagcggaggcgggggggggtcccggggacgtccccggttttcggggtcgc
tcccgttcggccccccccgtgctctgggccgcccgacgctacggccgccagctgcggcggatgagcgacgagttccagct
ccaggtgctgccacgccccaagagcctggggggggcccccccagggcgggagggggggtggcgggagaccctacgggcct
ggtggggggcccgacgccccccccgccccgctcccccggcccccccgccctga
>gnl|bcl2dbcds|A0A8B9NIC6_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Accipiter nisus GN=BAD (length=435 residues).
gtgggacaccccccaaatatttgggagggcaccccaaaacctctcattaccccccccatacgagtggggcttggtttggg
tggggatggggggggcacccaggtttgggggggcgcccactccccttattctcccttccgagaaggggggggggaggggc
ggggccggctgggagcggaggcgggggggggtcccggggacgtccccggttttcggggtcgctcccgttcggcccccccc
gtgctctgggccgcccgacgctacggccgccagctgcggcggatgagcgacgagttccagctccaggtgctgccacgccc
caagagcctggggggggcccccccagggcgggagggggggtggcgggagaccctacgggcctggtggggggcccgacgcc
ccccccgccccgctcccccggcccccccgccctga
© 1998-2022Legal notice