Dataset for CDS BAD of organism Accipiter nisus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9NIC6_BAD-01      atgttcagcctggaggagttcccggaggagcccggctccccccccgcctc
A0A8B9NIC6_BAD-02      gtgggacaccccccaaatatttgggaggg-------caccccaaaacctc
                        **     **      *  *   *****          ****    ****

A0A8B9NIC6_BAD-01      cccctgggggggttcgcccccccccattgcatttgacggggggtaccatg
A0A8B9NIC6_BAD-02      tcatta-----------ccccccccat--------acgagtggggcttgg
                        *  *            **********        *** * **  *   *

A0A8B9NIC6_BAD-01      gtggggt---gacgtggagatccctgacacccccccttctttatttgtgc
A0A8B9NIC6_BAD-02      tttgggtggggatgggggg------ggcaccca----ggtttgggggggc
                        * ****   ** * ** *      * *****       ***    * **

A0A8B9NIC6_BAD-01      cccccctcctccccaatttttcc-----------------agaggggcgg
A0A8B9NIC6_BAD-02      gcccactc--cccttattctcccttccgagaaggggggggggaggggcgg
                        *** ***  ***  *** * **                  *********

A0A8B9NIC6_BAD-01      ggccggctgggagcggaggcgggggggggtcccggggacgtccccggttt
A0A8B9NIC6_BAD-02      ggccggctgggagcggaggcgggggggggtcccggggacgtccccggttt
                       **************************************************

A0A8B9NIC6_BAD-01      tcggggtcgctcccgttcggccccccccgtgctctgggccgcccgacgct
A0A8B9NIC6_BAD-02      tcggggtcgctcccgttcggccccccccgtgctctgggccgcccgacgct
                       **************************************************

A0A8B9NIC6_BAD-01      acggccgccagctgcggcggatgagcgacgagttccagctccaggtgctg
A0A8B9NIC6_BAD-02      acggccgccagctgcggcggatgagcgacgagttccagctccaggtgctg
                       **************************************************

A0A8B9NIC6_BAD-01      ccacgccccaagagcctggggggggcccccccagggcgggagggggggtg
A0A8B9NIC6_BAD-02      ccacgccccaagagcctggggggggcccccccagggcgggagggggggtg
                       **************************************************

A0A8B9NIC6_BAD-01      gcgggagaccctacgggcctggtggggggcccgacgccccccccgccccg
A0A8B9NIC6_BAD-02      gcgggagaccctacgggcctggtggggggcccgacgccccccccgccccg
                       **************************************************

A0A8B9NIC6_BAD-01      ctcccccggcccccccgccctga
A0A8B9NIC6_BAD-02      ctcccccggcccccccgccctga
                       ***********************

© 1998-2022Legal notice