Dataset for CDS iridoviridae of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

38 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A6M8PQB5_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
Q2WEP2_097R-01          atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
I2BFW4_097R-01          atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A7G9TL46_097R-01      atgggcgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
D3TTY2_097R-01          atgggcgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A0D3R3I2_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A192GQ13_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A3Q8UH03_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
H6WEE3_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A223PJ87_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
Q6GZM8_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
H9XFR8_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
W8TMV3_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2U9QGY4_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2U9QHH2_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A220IH18_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2P1GJP0_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
C3RWV2_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A6M5K8N1_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A222NTZ1_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A1B2ITU5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0A0VDG1_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A2D0XKG8_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A223PJJ8_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0D3R3S5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A222NTN8_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
T2C510_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
V5N073_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2D0XMC5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0U2QBA9_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0U2QHX4_097R-01      atggacgtgaggcaatttctgttagactgcgaagctcccgaggagatggt
Q6YH32_097R-01          atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0U2R7T3_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A3Q9T2R6_097R-01      atggacgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A3Q9T8U5_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
Q677S5_070L-01          at-gatgagcaacaaatttgaaaccgatacaaaa-tatcttattgatgca
Q5GAF0_ORF115R-01       at-gacgaat-ataaacttttcagcgttgttgag-aggcgagcgcatgtg
Q5YFF0_ORF115R-01       at-gacgaac-ataaacttttcagcgttgttgag-aggcgagcgcatgtg
                        ** *  *      **  *         *    *     *      ***  

A0A6M8PQB5_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
Q2WEP2_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
I2BFW4_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
A0A7G9TL46_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
D3TTY2_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
A0A0D3R3I2_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A192GQ13_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A3Q8UH03_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
H6WEE3_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
A0A223PJ87_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
Q6GZM8_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
H9XFR8_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
W8TMV3_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
A0A2U9QGY4_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A2U9QHH2_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A220IH18_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A2P1GJP0_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
C3RWV2_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
A0A6M5K8N1_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A222NTZ1_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A1B2ITU5_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A0A0VDG1_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A2D0XKG8_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A223PJJ8_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A0D3R3S5_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A222NTN8_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
T2C510_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
V5N073_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
A0A2D0XMC5_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A0U2QBA9_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A0U2QHX4_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
Q6YH32_097R-01          ggccctgagggccg------------ccgcggacgccgtggg--------
A0A0U2R7T3_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A3Q9T2R6_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
A0A3Q9T8U5_097R-01      ggccctgagggccg------------ccgcggacgccgtggg--------
Q677S5_070L-01          ttttttaaag-----aatattttaattcacaa-----gaaagtaatgata
Q5GAF0_ORF115R-01       tcctctcacgcgcgaaatac----actcgcaaatgttgatcgtaacga--
Q5YFF0_ORF115R-01       tcctctcacgcgcgaaatac----actcgcaaatgttgatcgtaacga--
                             * * *                 * *       *   *        

A0A6M8PQB5_097R-01      -------------------------ggtagaca----acagggccttcgc
Q2WEP2_097R-01          -------------------------ggtagaca----acagggccttcgc
I2BFW4_097R-01          -------------------------ggtagaca----acagggcctgcgc
A0A7G9TL46_097R-01      -------------------------ggtagaca----acagggcctgcgc
D3TTY2_097R-01          -------------------------ggtagaca----acagggcctgcgc
A0A0D3R3I2_097R-01      -------------------------gatagaca----acagggcctgcgc
A0A192GQ13_097R-01      -------------------------agtagaca----acaaggcctgcgc
A0A3Q8UH03_097R-01      -------------------------agtagaca----acaaggcctgcgc
H6WEE3_097R-01          -------------------------ggtagaca----acagggcctgcgc
A0A223PJ87_097R-01      -------------------------ggtagaca----acagggcctgcgc
Q6GZM8_097R-01          -------------------------agtagaca----acagggcctgcgc
H9XFR8_097R-01          -------------------------agtagaca----acagggcctgcgc
W8TMV3_097R-01          -------------------------agtagaca----acagggcctgcgc
A0A2U9QGY4_097R-01      -------------------------agtagaca----acagggcctgcgc
A0A2U9QHH2_097R-01      -------------------------agtagaca----acagggcctgcgc
A0A220IH18_097R-01      -------------------------agtagaca----acagggcctgcgc
A0A2P1GJP0_097R-01      -------------------------agtagaca----acagggcctgcgc
C3RWV2_097R-01          -------------------------agtagaca----acagggcctgcgc
A0A6M5K8N1_097R-01      -------------------------ggtagaca----acagggcctgcgt
A0A222NTZ1_097R-01      -------------------------ggtagaca----acagggcctgcgc
A0A1B2ITU5_097R-01      -------------------------ggtagaca----acagggcctgcgc
A0A0A0VDG1_097R-01      -------------------------ggtagaca----acagggcatgcgc
A0A2D0XKG8_097R-01      -------------------------ggtagaca----acagggcatgcgc
A0A223PJJ8_097R-01      -------------------------ggtagaca----acagggcctgcac
A0A0D3R3S5_097R-01      -------------------------ggtagaca----acagggcctgcgc
A0A222NTN8_097R-01      -------------------------ggtagaca----acagggcctgcgc
T2C510_097R-01          -------------------------ggtagaca----acagggcctgcgc
V5N073_097R-01          -------------------------ggtagaca----acagggcctgcgc
A0A2D0XMC5_097R-01      -------------------------ggtagaca----acagggcctgcgc
A0A0U2QBA9_097R-01      -------------------------ggtagaca----acatggcctgtgc
A0A0U2QHX4_097R-01      -------------------------ggtagaca----acatggcctgtgc
Q6YH32_097R-01          -------------------------ggtagaca----acatggcctgtgc
A0A0U2R7T3_097R-01      -------------------------ggtagaca----acatggcctgtgc
A0A3Q9T2R6_097R-01      -------------------------ggtagaca----acagtgcctgcgc
A0A3Q9T8U5_097R-01      -------------------------ggtagaca----acagggcctgcgc
Q677S5_070L-01          taattttaaaaactataaaaaaagaggtaaatattttatttgataaacat
Q5GAF0_ORF115R-01       -aatcttacagttt-----------ggtggaaacgtttcgcgctttcccc
Q5YFF0_ORF115R-01       -aatcttacagttt-----------ggtagaaacgtttcgcgctttcccc
                                                   *  * *                 

A0A6M8PQB5_097R-01      ccacctatacaccatgctgtg--------------------------gga
Q2WEP2_097R-01          ccacctatacaccatgctgtg--------------------------gga
I2BFW4_097R-01          ccacctgtacaccatgctgtg--------------------------gga
A0A7G9TL46_097R-01      ccacctgtacaccatgctgtg--------------------------gga
D3TTY2_097R-01          ccacctgtacaccatgctgtg--------------------------gga
A0A0D3R3I2_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A192GQ13_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A3Q8UH03_097R-01      ccacctatacaccatgctgtg--------------------------gga
H6WEE3_097R-01          ccacctatacaccatgctgtg--------------------------gga
A0A223PJ87_097R-01      ccacctatacaccatgctgtg--------------------------gga
Q6GZM8_097R-01          ccacctatacaccatgctgtg--------------------------gga
H9XFR8_097R-01          ccacctatacaccatgctgtg--------------------------gga
W8TMV3_097R-01          ccacctatacaccatgctgtg--------------------------gga
A0A2U9QGY4_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A2U9QHH2_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A220IH18_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A2P1GJP0_097R-01      ccacctatacaccatgctgtg--------------------------gga
C3RWV2_097R-01          ccacctatacaccatgctgtg--------------------------gga
A0A6M5K8N1_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A222NTZ1_097R-01      ccacctatacaccatgttgtg--------------------------gga
A0A1B2ITU5_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A0A0VDG1_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A2D0XKG8_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A223PJJ8_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A0D3R3S5_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A222NTN8_097R-01      ccacctatacaccatgctgtg--------------------------gga
T2C510_097R-01          ccacctatacaccatgctgtg--------------------------gga
V5N073_097R-01          ccacctatacaccatgctgtg--------------------------gga
A0A2D0XMC5_097R-01      ccacctatacaccatgctgtg--------------------------gga
A0A0U2QBA9_097R-01      ccacctgtacaccatgctgtg--------------------------gga
A0A0U2QHX4_097R-01      ccacctgtacaccatgctgtg--------------------------gga
Q6YH32_097R-01          ccacctgtacaccatgctgtg--------------------------gga
A0A0U2R7T3_097R-01      ccacctgtacaccatgctgtg--------------------------gga
A0A3Q9T2R6_097R-01      acacctgtacaccatgcattg--------------------------gga
A0A3Q9T8U5_097R-01      acacctgtacaccatgcagtg--------------------------gga
Q677S5_070L-01          agacttgtttattctaatatgataaatgatatatctattactactgaaat
Q5GAF0_ORF115R-01       agact------------------------------------------gcc
Q5YFF0_ORF115R-01       agact------------------------------------------gcc

A0A6M8PQB5_097R-01      aggcgtt----------aacctggaggaggttcacgcatccctcctgaga
Q2WEP2_097R-01          aggcgtt----------aacctggaggaggttcacgcatccctcctgaga
I2BFW4_097R-01          aggcgtc----------aacctggaggatgttcacgcatccctcctggga
A0A7G9TL46_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
D3TTY2_097R-01          aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A0D3R3I2_097R-01      aggtgtc----------aacctggaggaggttcacgcatccctcctggga
A0A192GQ13_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A3Q8UH03_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
H6WEE3_097R-01          aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A223PJ87_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
Q6GZM8_097R-01          aggcgtc----------aacctggaggaggttcacgcatccctcctggga
H9XFR8_097R-01          aggcgtc----------agcctggaggaggttcacgcatccctcctggga
W8TMV3_097R-01          aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A2U9QGY4_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A2U9QHH2_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A220IH18_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A2P1GJP0_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
C3RWV2_097R-01          aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A6M5K8N1_097R-01      aggcatc----------aacctggaggaggttcacgcatccctcctggga
A0A222NTZ1_097R-01      aggtgtc----------aacctggaggaggttcacgcatccctcctggga
A0A1B2ITU5_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A0A0VDG1_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A2D0XKG8_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A223PJJ8_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A0D3R3S5_097R-01      aggcgtc----------aacctggaggaggtgcacgcatccctcctggga
A0A222NTN8_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
T2C510_097R-01          aggcgtc----------aacctggaggaggttcacgcatccctcctggga
V5N073_097R-01          aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A2D0XMC5_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A0U2QBA9_097R-01      aggcatc----------aacctggaggaggttcacgcatccttcctggga
A0A0U2QHX4_097R-01      aggcgtc----------aacctggaggaggttcacgcatccttcctggga
Q6YH32_097R-01          aggcgtc----------aacctggaggaggttcacgcatccttcctggga
A0A0U2R7T3_097R-01      aggcgtc----------aacctggaggaggttcacgcatccttcctggga
A0A3Q9T2R6_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
A0A3Q9T8U5_097R-01      aggcgtc----------aacctggaggaggttcacgcatccctcctggga
Q677S5_070L-01          agatattttagttaaaaaaactgctgaaagt------atattttct----
Q5GAF0_ORF115R-01       aaatattttag------aaattggcaacaat------atcgtttcg----
Q5YFF0_ORF115R-01       aaatattttag------aaattggcaacaat------atcgtttcg----
                        *    *           *   **       *      **   * *     

A0A6M8PQB5_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
Q2WEP2_097R-01          gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
I2BFW4_097R-01          gacggcgttgtaaactggggcagggtggccgcgtttatgcacgtctgc--
A0A7G9TL46_097R-01      gacggcattgtaaactggggcagggtggccgcgtttatgcacatctgc--
D3TTY2_097R-01          gacggcattgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A0D3R3I2_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A192GQ13_097R-01      gacggcgttgtaaactggggcagggtggccgtgtttatgcacatctgc--
A0A3Q8UH03_097R-01      gacggcgttgtaaactggggcagggtggccgtgtttatgcacatctgc--
H6WEE3_097R-01          gacggcgttgtaaactggggcaggatggccgcgtttatgcacatctgc--
A0A223PJ87_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
Q6GZM8_097R-01          gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
H9XFR8_097R-01          gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
W8TMV3_097R-01          gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A2U9QGY4_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A2U9QHH2_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A220IH18_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A2P1GJP0_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
C3RWV2_097R-01          gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A6M5K8N1_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A222NTZ1_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A1B2ITU5_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A0A0VDG1_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A2D0XKG8_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A223PJJ8_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A0D3R3S5_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A222NTN8_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
T2C510_097R-01          gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
V5N073_097R-01          gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A2D0XMC5_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A0U2QBA9_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A0U2QHX4_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
Q6YH32_097R-01          gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A0U2R7T3_097R-01      gacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgc--
A0A3Q9T2R6_097R-01      gacggcgttgtaaactggggtagggtggccgtgtttatgcacgtctgc--
A0A3Q9T8U5_097R-01      gacggcgttgtaaactggggtagggtggccgtgtttatgcacatctgc--
Q677S5_070L-01          gatggtttagttaattggggtagaataatta-gtttaattacctttgg--
Q5GAF0_ORF115R-01       gacggcaacttgaattgggggagaat-------tttga-tactgttgggc
Q5YFF0_ORF115R-01       gacggcaacttgaattgggggagaat-------tttga-tactgttgggc
                        ** **     * ** ***** **  *       ***    **   **   

A0A6M8PQB5_097R-01      -------aggtacatcgtcaggacctttccgtc-----------cagcat
Q2WEP2_097R-01          -------aggtacatcgtcaggacctttccgtc-----------cagcat
I2BFW4_097R-01          -------aggtataccgtcaggacctttccgtc-----------tagcat
A0A7G9TL46_097R-01      -------aggtacaccgtcaggacctttccatc-----------tagcat
D3TTY2_097R-01          -------aggtacaccgtcaggacctttccatc-----------tagcat
A0A0D3R3I2_097R-01      -------aggtacattgtcaggacctttccgtc-----------tagcat
A0A192GQ13_097R-01      -------aggtacatcgtcaggacctttccgtc-----------cagcat
A0A3Q8UH03_097R-01      -------aggtacatcgtcaggatctttccgtc-----------cagcat
H6WEE3_097R-01          -------agatacatcgtcaggacctttccgtc-----------tagcat
A0A223PJ87_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
Q6GZM8_097R-01          -------aggtacatcgtcaggacctttccgtc-----------cagcat
H9XFR8_097R-01          -------aggtacatcgtcaggacctttccgtc-----------cagcat
W8TMV3_097R-01          -------aggtacatcgtcaggacctttccgtc-----------cagcat
A0A2U9QGY4_097R-01      -------aggtacatcgtcaggacctttccgtc-----------cagcat
A0A2U9QHH2_097R-01      -------aggtacatcgtcaggacctttccgtc-----------cagcat
A0A220IH18_097R-01      -------aggtacatcgtcaggacctttccgtc-----------cagcat
A0A2P1GJP0_097R-01      -------aggtacatcgtcaggacctttccgtc-----------cagcat
C3RWV2_097R-01          -------aggtacatcgtcaggacctttccgtc-----------cagcat
A0A6M5K8N1_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
A0A222NTZ1_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
A0A1B2ITU5_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
A0A0A0VDG1_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
A0A2D0XKG8_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
A0A223PJJ8_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
A0A0D3R3S5_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
A0A222NTN8_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
T2C510_097R-01          -------aggtacatcgtcaggacctttccgtc-----------tagcat
V5N073_097R-01          -------aggtacatcgtcaggacctttccgtc-----------tagcat
A0A2D0XMC5_097R-01      -------aggtacatcgtcaggacctttccgtc-----------tagcat
A0A0U2QBA9_097R-01      -------aggtacaccgtcaggacctttccgtc-----------tagcat
A0A0U2QHX4_097R-01      -------aggtacaccgtcaggacctttccgtc-----------tagcat
Q6YH32_097R-01          -------aggtacaccgtcaggacctttccgtc-----------tagcat
A0A0U2R7T3_097R-01      -------aggtacaccgtcaggacctttccgtc-----------tagcat
A0A3Q9T2R6_097R-01      -------aggtacaccgtcaggacctttccgtc-----------tagcat
A0A3Q9T8U5_097R-01      -------aggtacaccgtcaggacctttccgtc-----------tagcat
Q677S5_070L-01          -------aattttaatcgttgaatatttaaa----aacaataaataatac
Q5GAF0_ORF115R-01       atctctcaactttactt-tacaaaatccgaatcggaatcggaaagaacac
Q5YFF0_ORF115R-01       atctctcaactttactt-tacaaaatccgaatcggaatcggaaagaacac
                               *  *  *        *  *                   *  * 

A0A6M8PQB5_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
Q2WEP2_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
I2BFW4_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaag
A0A7G9TL46_097R-01      ggatagggcagaggttgctctgacta-aatttatacaggac----ccaaa
D3TTY2_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A0D3R3I2_097R-01      ggataggacagaggttgcgctaacta-aatttatacaggac----ccaaa
A0A192GQ13_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A3Q8UH03_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
H6WEE3_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A223PJ87_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
Q6GZM8_097R-01          ggatagaacagaggttgctctgacta-aatttatacaggac----ccaaa
H9XFR8_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
W8TMV3_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A2U9QGY4_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A2U9QHH2_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A220IH18_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A2P1GJP0_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
C3RWV2_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A6M5K8N1_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A222NTZ1_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A1B2ITU5_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A0A0VDG1_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A2D0XKG8_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A223PJJ8_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A0D3R3S5_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A222NTN8_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
T2C510_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
V5N073_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A2D0XMC5_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A0U2QBA9_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A0U2QHX4_097R-01      ggataggacagaggttgctttgacta-aatttatacaggac----ccaaa
Q6YH32_097R-01          ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
A0A0U2R7T3_097R-01      ggataggacagaggttgctttgacta-aatttatacaggac----ccaaa
A0A3Q9T2R6_097R-01      ggataggacagaggttgcgctgacta-aatttatacaggac----ccaaa
A0A3Q9T8U5_097R-01      ggataggacagaggttgctctgacta-aatttatacaggac----ccaaa
Q677S5_070L-01          tgataaaataacatctgtaagtactattattt-------------cctca
Q5GAF0_ORF115R-01       agataacggaacaact---cgaacgatttttcaggcaagacgcgatctca
Q5YFF0_ORF115R-01       agataacggaacaact---cgaacgatttttcaggcaagacgcgatctca
                         ****    *     *      ** *   **               *   

A0A6M8PQB5_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
Q2WEP2_097R-01          gatagacaagcaactcagagagtggacagatag------------gctgg
I2BFW4_097R-01          ggtagacaagcacctcagagagtggacagatag------------gctgg
A0A7G9TL46_097R-01      gatagacgagcacctcagagagtggacagatag------------gctgg
D3TTY2_097R-01          gatagacgagcacctcagagagtggacagatag------------gctgg
A0A0D3R3I2_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A192GQ13_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A3Q8UH03_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
H6WEE3_097R-01          gatagacaagcaactcagagagtggacagatag------------gctgg
A0A223PJ87_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
Q6GZM8_097R-01          gatagacaagcaactcagagagtggacagatag------------gctgg
H9XFR8_097R-01          gatagacaagcaactcagagagtggacagatag------------gctgg
W8TMV3_097R-01          gatagacaagcaactcagagagtggacagatag------------gctgg
A0A2U9QGY4_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A2U9QHH2_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A220IH18_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A2P1GJP0_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
C3RWV2_097R-01          gatagacaagcaactcagagagtggacagatag------------gctgg
A0A6M5K8N1_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A222NTZ1_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A1B2ITU5_097R-01      gatagacaagcaactcagagagtggacagatag------------actgg
A0A0A0VDG1_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A2D0XKG8_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A223PJJ8_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A0D3R3S5_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A222NTN8_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
T2C510_097R-01          gatagacaagcaactcagagagtggacagatag------------gctgg
V5N073_097R-01          gatagacaagcaactcagagagtggacagatag------------gctgg
A0A2D0XMC5_097R-01      gatagacaagcaactcagagagtggacagatag------------gctgg
A0A0U2QBA9_097R-01      gatatacaagcacctcagagagtggacagatag------------gctgg
A0A0U2QHX4_097R-01      gatatacaagcacctcagagagtggacagatag------------gctgg
Q6YH32_097R-01          gatatacaagcacctcagagagtggacagatag------------gctgg
A0A0U2R7T3_097R-01      gatatacaagcacctcagagagtggacagatag------------gctgg
A0A3Q9T2R6_097R-01      aatatacaagcacctcagagagtggacagatag------------gctgg
A0A3Q9T8U5_097R-01      gatatacaagcacctcagagagtggacagatag------------gctgg
Q677S5_070L-01          tatttaatagaacatcagaagca--ttggttaataaaaaataatgcatgg
Q5GAF0_ORF115R-01       aattggatcg--cgtcaaacggaggctgggtaa------------cgtgc
Q5YFF0_ORF115R-01       aattggatcg--tgtcaaacggaggctgggtaa------------cgtgc
                          *      *    *** *         * **               ** 

A0A6M8PQB5_097R-01      gtacagttggg-gtgattg-----------ggaaatgctta---------
Q2WEP2_097R-01          gtacagttggg-gtgattg-----------ggaaatgctta---------
I2BFW4_097R-01          gtacagtcggg-gtgattg-----------ggagatgcttagagtggttg
A0A7G9TL46_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
D3TTY2_097R-01          gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A0D3R3I2_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A192GQ13_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A3Q8UH03_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
H6WEE3_097R-01          gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A223PJ87_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
Q6GZM8_097R-01          gtacagtcggg-ctgattg-----------ggagatgctta---------
H9XFR8_097R-01          gtacagtcggg-gtgattg-----------ggagatgctta---------
W8TMV3_097R-01          gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A2U9QGY4_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A2U9QHH2_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A220IH18_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A2P1GJP0_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
C3RWV2_097R-01          gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A6M5K8N1_097R-01      gtacagtcagg-gtgattg-----------ggagatgctta---------
A0A222NTZ1_097R-01      gtacagtcagg-gtgattg-----------ggagatgctta---------
A0A1B2ITU5_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A0A0VDG1_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A2D0XKG8_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A223PJJ8_097R-01      gtacagtcagg-gtgattg-----------ggagatgctta---------
A0A0D3R3S5_097R-01      gtacagtcagg-gtgattg-----------ggagatgctta---------
A0A222NTN8_097R-01      gtacagtcagg-gtgattg-----------ggagatgctta---------
T2C510_097R-01          gtacagtcagg-gtgattg-----------ggagatgctta---------
V5N073_097R-01          gtacagtcagg-gtgattg-----------ggagatgctta---------
A0A2D0XMC5_097R-01      gtacagtcagg-gtgattg-----------ggagatgctta---------
A0A0U2QBA9_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A0U2QHX4_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
Q6YH32_097R-01          gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A0U2R7T3_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A3Q9T2R6_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
A0A3Q9T8U5_097R-01      gtacagtcggg-gtgattg-----------ggagatgctta---------
Q677S5_070L-01          ataggattgg--ttgatttttttactgttcaaacttataca------tca
Q5GAF0_ORF115R-01       gcaagcttggacttga--------------gaaactactct------tcg
Q5YFF0_ORF115R-01       gcaagcttggacttga--------------gaaactactct------tcg
                          *   *  *   ***                *  *              

A0A6M8PQB5_097R-01      ------gagtggttgggag------------------------cgggagt
Q2WEP2_097R-01          ------gagtggttgggagcgggagtgataacgggagtgataacgggagt
I2BFW4_097R-01          gagcgggagtggttgggagtg------------ggagtgatcactggagt
A0A7G9TL46_097R-01      ------gagtggttgggagcg------------------------ggagt
D3TTY2_097R-01          ------gagtggttgggagcg------------------------ggagt
A0A0D3R3I2_097R-01      ------gagtggttgggagtg------------------------ggagt
A0A192GQ13_097R-01      ------gagtggttgggagcg------------ggagcgatcgcgggagt
A0A3Q8UH03_097R-01      ------gagtggttgggagcg------------ggagcgatcgcgggagt
H6WEE3_097R-01          ------gagtggttgggagcg------------------------ggagt
A0A223PJ87_097R-01      ------gagtggttgggagcg------------------------ggagt
Q6GZM8_097R-01          ------gagtggttgggagcg------------------------ggagt
H9XFR8_097R-01          ------gagtggttgggagcg------------------------ggagt
W8TMV3_097R-01          ------gagtggttgggagcg------------------------ggagt
A0A2U9QGY4_097R-01      ------gagtggttgggagcg------------------------ggagt
A0A2U9QHH2_097R-01      ------gagtggttgggagcg------------------------ggagt
A0A220IH18_097R-01      ------gagtggttgggagcg------------------------ggagt
A0A2P1GJP0_097R-01      ------gagtggttgggagcg------------------------ggagt
C3RWV2_097R-01          ------gagtggttgggagcg------------------------ggagt
A0A6M5K8N1_097R-01      ------gagtggttgggagcg------------------------ggagt
A0A222NTZ1_097R-01      ------gagtggttgggagcg------------------------ggagt
A0A1B2ITU5_097R-01      ------gagtggttgggagcg------------------------ggagt
A0A0A0VDG1_097R-01      ------gagtggttgggagcgggagtgatcactggagtgatcactggagt
A0A2D0XKG8_097R-01      ------gagtggttgggagcg------------ggagtgatcactggagt
A0A223PJJ8_097R-01      ------gagtggttgggagcg------------------------ggagt
A0A0D3R3S5_097R-01      ------gagtggttgggagcg------------ggagtgatcactggagt
A0A222NTN8_097R-01      ------gagtggttgggagcg------------ggagtgatcactggagt
T2C510_097R-01          ------gagtggttgggagcg------------------------ggagt
V5N073_097R-01          ------gagtggttgggagcg------------------------ggagt
A0A2D0XMC5_097R-01      ------gagtggttgggagcg------------ggagtgatcactggagt
A0A0U2QBA9_097R-01      ------aaatggttgggagcg------------------------ggagt
A0A0U2QHX4_097R-01      ------aagtggttgggagcg------------------------ggagt
Q6YH32_097R-01          ------aagtggttgggagcg------------------------ggagt
A0A0U2R7T3_097R-01      ------aagtggttgggagcg------------------------ggagt
A0A3Q9T2R6_097R-01      ------gagtggttgggagcg------------------------ggagt
A0A3Q9T8U5_097R-01      ------gagtggttgggagcg------------------------ggagt
Q677S5_070L-01          cccgttaaatctttacttacc------ttttttatagtttttatgggtac
Q5GAF0_ORF115R-01       gtaaccaacgctttgcaagccatgtgttttttcggcgctttgtttggaac
Q5YFF0_ORF115R-01       gtaaccaacgctttgcaagccatgtgttttttcggcgctttgtttggaac
                               *    **                               **   

A0A6M8PQB5_097R-01      gataacgggagtgataacgggagtga------------------tcctgt
Q2WEP2_097R-01          gataacgggagtgataacgggagtga------------------tcctgt
I2BFW4_097R-01          gatcactggagtgg------------------------------tcctgt
A0A7G9TL46_097R-01      gatcactggagtgg------------------------------tcctgt
D3TTY2_097R-01          gatcactggagtgg------------------------------tcctgt
A0A0D3R3I2_097R-01      gatcactggagtgg------------------------------tcctgt
A0A192GQ13_097R-01      gatcgctggagtgg------------------------------tcctgt
A0A3Q8UH03_097R-01      gatcgctggagtgg------------------------------tcctgt
H6WEE3_097R-01          gatcactggagtgg------------------------------tcctgt
A0A223PJ87_097R-01      gatcactggagtgg------------------------------tcctat
Q6GZM8_097R-01          gatcactggagtgg------------------------------tcctat
H9XFR8_097R-01          gatcactggagtgg------------------------------tcctgt
W8TMV3_097R-01          gatcactggagtgg------------------------------tcctat
A0A2U9QGY4_097R-01      gatcactggagtgg------------------------------tcctat
A0A2U9QHH2_097R-01      gatcactggagtgg------------------------------tcctat
A0A220IH18_097R-01      gatcactggagtgg------------------------------tcctgt
A0A2P1GJP0_097R-01      gatcactggagtgg------------------------------tcctgt
C3RWV2_097R-01          gatcactggagtgg------------------------------tcctgt
A0A6M5K8N1_097R-01      gatcactggagtgg------------------------------tcctgt
A0A222NTZ1_097R-01      gatcactggagtgg------------------------------tcctgt
A0A1B2ITU5_097R-01      gatcactggagtgg------------------------------tcctgt
A0A0A0VDG1_097R-01      gatcactggagtgg------------------------------tcctgt
A0A2D0XKG8_097R-01      gatcactggagtgg------------------------------tcctgt
A0A223PJJ8_097R-01      gatcactggagtgg------------------------------tcctgt
A0A0D3R3S5_097R-01      gatcactggagtgg------------------------------tcctgt
A0A222NTN8_097R-01      gatcactggagtgg------------------------------tcctgt
T2C510_097R-01          gatcactggagtgg------------------------------tcctgt
V5N073_097R-01          gatcactggagtgg------------------------------tcctgt
A0A2D0XMC5_097R-01      gatcactggagtgg------------------------------tcctgt
A0A0U2QBA9_097R-01      gatcactggagtgg------------------------------tcctgt
A0A0U2QHX4_097R-01      gatcactggagtgg------------------------------tcctgt
Q6YH32_097R-01          gatcactggagtgg------------------------------tcctgt
A0A0U2R7T3_097R-01      gatcactggagtgg------------------------------tcctgt
A0A3Q9T2R6_097R-01      gatcactggagtgatcactggagtggtcctgtctctcctgtctctcctgt
A0A3Q9T8U5_097R-01      gatcactggagtgatcactggagtgg------------------tcctgt
Q677S5_070L-01          aggagctatgttata-----------------------------ttcagc
Q5GAF0_ORF115R-01       aatagccgta----a-----------------------------tt--gc
Q5YFF0_ORF115R-01       aatagccgta----a-----------------------------tt--gc
                             *                                      *     

A0A6M8PQB5_097R-01      ctct--cttgttctcttga
Q2WEP2_097R-01          ctct--cttgttctcttga
I2BFW4_097R-01          ctct--cttgttctcttga
A0A7G9TL46_097R-01      ctct--cttgttctcttga
D3TTY2_097R-01          ctct--cttgttctcttga
A0A0D3R3I2_097R-01      ctct--cttgttctcttga
A0A192GQ13_097R-01      ctct--cttgttctcttga
A0A3Q8UH03_097R-01      ctct--cttgttctcttga
H6WEE3_097R-01          ctct--cttgttctcttga
A0A223PJ87_097R-01      ctct--cttgttctattga
Q6GZM8_097R-01          ctct--cttgttctattga
H9XFR8_097R-01          ctct--cttgttctattga
W8TMV3_097R-01          ctct--cttgttctattga
A0A2U9QGY4_097R-01      ctct--cttgttctattga
A0A2U9QHH2_097R-01      ctct--cttgttctattga
A0A220IH18_097R-01      ctct--cttgttctcttga
A0A2P1GJP0_097R-01      ctct--cttgttctattga
C3RWV2_097R-01          ctct--cttgttctattga
A0A6M5K8N1_097R-01      ctct--cttgttctcttga
A0A222NTZ1_097R-01      ctct--cttgttctcttga
A0A1B2ITU5_097R-01      ctct--cttgttctcttga
A0A0A0VDG1_097R-01      ctct--cttgttctcttga
A0A2D0XKG8_097R-01      ctct--cttgttctcttga
A0A223PJJ8_097R-01      ctct--cttgttctcttga
A0A0D3R3S5_097R-01      ctct--cttgttctcttga
A0A222NTN8_097R-01      ctct--cttgttctcttga
T2C510_097R-01          ctct--cttgttctcttga
V5N073_097R-01          ctct--cttgttctcttga
A0A2D0XMC5_097R-01      ctct--cttgttctcttga
A0A0U2QBA9_097R-01      ctct--tttgttctcttga
A0A0U2QHX4_097R-01      ctct--tttgttctcttga
Q6YH32_097R-01          ctct--tttgttctcttga
A0A0U2R7T3_097R-01      ctct--tttgttctcttga
A0A3Q9T2R6_097R-01      ctct--cttgttctcttga
A0A3Q9T8U5_097R-01      ctct--cttgttctcttga
Q677S5_070L-01          ttttaatttaacttattga
Q5GAF0_ORF115R-01       ttattatctgttaccatga
Q5YFF0_ORF115R-01       ttattatctgttaccatga
                         * *    *       ***

© 1998-2022Legal notice