Dataset for CDS LMW5-HL of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


D4I5M9_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
A9JLP1_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
D0Q0E8_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
P42485_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
A9JKY0_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
A0A0C5AZD3_LMW5HL-      atggagggagaagagctcatatatcataatatcattaatgaaatactcgt
A0A7R8V9Y5_LMW5HL-      atggagggagaagagctcatatatcataatatcattaatgaaatactcgt
                        *************** * ***************************** **

D4I5M9_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
A9JLP1_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
D0Q0E8_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
P42485_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
A9JKY0_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
A0A0C5AZD3_LMW5HL-      gggatatattaaatattacatgaatgatatttcagagcatgaacttagcc
A0A7R8V9Y5_LMW5HL-      gggatatattaaatattacatgaatgatatttcagagcatgaacttagcc
                        *** ***************** ******************** *******

D4I5M9_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
A9JLP1_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
D0Q0E8_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
P42485_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
A9JKY0_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
A0A0C5AZD3_LMW5HL-      cgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttg
A0A7R8V9Y5_LMW5HL-      cgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttg
                        * ** ** *********************************** ******

D4I5M9_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
A9JLP1_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
D0Q0E8_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
P42485_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
A9JKY0_LMW5HL-01        aacaaacaggttataattaccttttctcttacgagtgtccaagaaattaa
A0A0C5AZD3_LMW5HL-      aacaagcaggttacaattaccttttctcttacgagtgcccaagaaattaa
A0A7R8V9Y5_LMW5HL-      aacaagcaggttacaattaccttttctcttacgagtgcccaagaaattaa
                        ***** ******* *********************** ************

D4I5M9_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
A9JLP1_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
D0Q0E8_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
P42485_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
A9JKY0_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
A0A0C5AZD3_LMW5HL-      aacccagtttactgaggttgtgactgagttgtttaaggatcttatcaact
A0A7R8V9Y5_LMW5HL-      aacccagtttactgaggttgtgactgagttgtttaaggatcttatcaact
                        ************** ************* *********************

D4I5M9_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
A9JLP1_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
D0Q0E8_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
P42485_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
A9JKY0_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
A0A0C5AZD3_LMW5HL-      ggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtac
A0A7R8V9Y5_LMW5HL-      ggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtac
                        ************************************ ************ 

D4I5M9_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
A9JLP1_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
D0Q0E8_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
P42485_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
A9JKY0_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
A0A0C5AZD3_LMW5HL-      tgcaaagatgccaacaaccatctggagtccacggtgatcactacggcata
A0A7R8V9Y5_LMW5HL-      tgcaaagatgccaacaaccatctggagtccacggtgatcactacggcata
                        ******** ***** ***********************************

D4I5M9_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A9JLP1_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
D0Q0E8_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
P42485_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A9JKY0_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A0A0C5AZD3_LMW5HL-      caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A0A7R8V9Y5_LMW5HL-      caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
                        **************************************************

D4I5M9_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
A9JLP1_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
D0Q0E8_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
P42485_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
A9JKY0_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
A0A0C5AZD3_LMW5HL-      aagaggagtttttggctttctctctacacagtgacatttattccgtgatt
A0A7R8V9Y5_LMW5HL-      aagaggagtttttggctttctctctacacagtgacatttattccgtgatt
                        ************************************* ************

D4I5M9_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
A9JLP1_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
D0Q0E8_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
P42485_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
A9JKY0_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
A0A0C5AZD3_LMW5HL-      tttaatattaaatatttcttatctaaattttgtaatcacatgtttttaag
A0A7R8V9Y5_LMW5HL-      tttaatattaaatatttcttatctaaattttgtaatcacatgtttttaaa
                        *********************************************** * 

D4I5M9_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
A9JLP1_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
D0Q0E8_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
P42485_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
A9JKY0_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
A0A0C5AZD3_LMW5HL-      atcctgtgtacatttattaagaaactgcaatttgatctag
A0A7R8V9Y5_LMW5HL-      atcctgtgtacatttattaagaaactgcaatttgatctag
                        ************ *********************** ***

© 1998-2022Legal notice